Otolemur_garnettii Locus Mono:352:SNORD43
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:352:SNORD43
Otolemur_garnettii
Mono:352:SNORD43
GeneScaffold_805
SNORD43
1001..1064
2064
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNACAGTCTCAACCCAGTTTCAACTTTATCGGGAT
GAGCTTCCATGAGCAACACGCGGGATCAGGAAGACTTAGAGTGGGGGCGCTAGGCGCTGA
ACTGAGGAAGCTTGCGGGAGGGAGGATTGGGTTAGGATTGTTGAGGCCCTGTTCTGAAAT
AACTGGGGTGGTTGGTGCAACTTACTGGAATTCGCGGAAACCACAGGTGATGAACTCATT
GACGGGCGGACAGAGACGCTGTGCTGATCGTCATGTTCTGATTTGGCTCTGCGGCGTTCC
AGGGGCCTGCGTGTATTAGTCTGTACCCATTACCTACTGCCGGACCGTTTGTTCCGAAGT
TGTTGGTGGTCAGACTCTAGATGATTTGTCTATAAACCCACTTGTTAGGTTATTTCAATA
CTATTCAGTGTGTTTTTGTCTGCTGTCACAGACAATTTTCGTAGAAATTGAAACAAGTTG
GAGTAAACCTTAAACTCACATTTTGTTGAGTTTTAGTATGTTCTGGATTTGGGGATTCTT
GGGAAAAGGTGAACTTAGCATGTAATCACATTAACCTGGTTTTAGGCCCAGTCAAAAGTC
AGCACTGCTGAGAATGCTTAGAAACTAAGCAGATGGGAACTGAACTGAAGGCCGATTTGT
TTGGGGTGTTAATATTGGTATGATTTTCCTAGTCTCACAGGAAGTTCTCAGCTCCCAGAC
ATGGATCTCTGGGCTTCTTGCCTCGAAAGCGCAGCAGCAGGCATCGTGGGAAGGTGAAGA
GCTTCCCCAAGGATGATCCATCTAAGCCTGTCCACCTCACAGCCTTCCTGGGATACAAGG
CTGGCATGACCCACATCGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved