Otolemur_garnettii Locus Poly:10:SNORD116
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:10:SNORD116
Otolemur_garnettii
Poly:10:SNORD116
scaffold_82685
SNORD116, SNORD116
1001..1094, 2483..2574
3574
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGGAGACCCGACATATCCCATGGGTGTTGATATCATTA
CTTATTTTAGGGGAATTCATGGAGAAGAGAAGGCAGAAACTGCAAAACAGGATGTCAATG
AGAAGACAGGGACGTTACTCCACTGGCAAGGATGACAGTGCAGTGGCCACCTCTGTGTTT
GCATCCTTTTCTGAGGCTTGTATGCAATTTGTGTCCACTTCTCAGGGGCAGTCACCTTGA
GACATGCCATCAGTGGGGAGGATGAAGTGCATTCCTTCTTAGGACAGAAGTGCTTGGGAT
CCTGGAATCTCTGTGGCCAAGGATGGCAGTTCACTCTGGAGGGTAATCATTTCCTGGGGT
GGAGGGGTAACTCTGTGTTTTGGATTTTGTAGCTCCTCCCGTGAATGGCTCCTCAGTGGT
GTGGCTCTGGTTTCTCCGGGGTGCGTAATATCTTAGTGATCACTGGCTCTCCCACTGCCA
AGTCCCATGGGGTAAAATTTCTAGCATGTTGTAACATGCTTGGATTGATGATGATTCCCC
TGTCCAAACATTCCTTGGAAAAGGTGAACAAAATGAGTGAAACTCACTACTATCTCACTC
TTCAGAACTGAGTCCAGCACATTGCCTGAACCAGGGCTTTTCCGAGAGCGGTACAACATG
GACTGCTTCACATTCTTGCCATCCCTTCAGGACACTCACAGTGGGAGTTCTCTCTGATCA
GTGGCATCAGTAACATGGCCGCACACAATGCCCTGGGTAGGAGAGTTGTGGAATTTTAGG
GCATGGTAGACATTTCAAACCAGGTCATCAAAGGGTGGTTCTTGTGACTACTTCCATTGC
GGGGCCTCGTGCTGGTCTATGTGTGCACTCTTCTTGTCAGAGGATTCAGCCTGATTGTCC
AATGGGCAAATCACCTATGGCACTTGGGTGTAATCATGGCCTTGGGCAAGTTTTTTTGGA
GCCCCCCAAATGGAGAGCTCTTACATGTTAAGGCAGTTTCCAGCTGCCTTTTGTCTACAA
CGTACTGAGCTAAGGTATCGCCTATGATTTCCTCAGGTAAATTGTGGGTTGAGGAAAATT
TATCACTTCACTTTTTTTCGTGGCATCTTCTCGGGTATGTATACCTGTAAGGTCTCTACG
TGGACATTCCTCACTTGTTTCTTCCATGGGGTACTTTTCCATTTAGTCCTGTTGTTCTTA
TATTACCAGCTGTGTCATGATAGGGTTGTTGTGTAGCATCCTGAGCCAGGTATGAGTCCG
CTCTGAACTTTAAGGCGATGGTGGGTGGAAGAGTACATGCTGAGCTGGACAAAATTTTGG
GATTCAGAATTATAGAAACATATTATCTTGATGATGATTGTTTCCTATGAGTTTAGTTTC
TCTTGTAAGGAAGCCTGAGTAGTATTGTGCTCTGCGCCATTAGTTGTAGCAGTTAGATCT
GCCATTCCAGTGCTAGAGGAAATCTCCTTTTAAGGGGGATGGAAGAGGTTTTCTCTTAAA
CTATTTCCATGCAACTATCCCACTGGTATTTGTCTCTTGTGATGGGACACAGGGCAACTT
TGCTTAAGGAGTGACAAACACCTTTTACTGAGAAGTTTGTTCTTTGGCTGTGCTCTTGAA
CATGGTAATGCAGTTCCCATTATCATGTGACTGAGAGCTGCAGCCCCAGTCACTCATGTT
CATGTGTCCACAGAATATGGGGAAGTTCATGAAGGTCTGCTGGTGGTTTTAATACAGGGG
CTTAATGGCTCCACCCTTTACCTCTGTGTTCCTGTCTGATGTTCTCAGGTATGCATGTAT
TCCCTCTTTAGTTTGCAGATGCTGTTGCCATGGAAGGAATCTCTGTTGTCCTCAGGGAGA
GCTTCATATCATGTTGTTCCTGGACATTGGAGGAACCTTGTGGACAATTGTGGTGTGGCC
TTCTCTGTGCTGTTGAATTTTTTTGGAAGGTAAGTGTCTCTTTTCCTAAGCAGGCCTCTT
GTATAGGTGGAAAAACTGTTCATGGATCAACTACGACTTTCATATATGCATTACTTAGAA
AGCTGAACAATATGATTAAAAACCCTATACCCTCATCGTTATCAAACTGATGCCCAGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTGGTATATGATGCTTAAGTGATCTCTCACAAATGAGGGGAATTTTTTCTTT
CTGTCCTGCTATTTTAGACTCTTTATCAGCAAGTCAGTTACTTTCAGAAATATCATCTGA
GGTCTTTTGGTGTCACTTCCAATGAATAACAGCTACTTCTTATGGGGGCATTTAAAGCTT
GTAATAAATAACCTGTCTATTTTATGATGATATTTTATGGCAGAGCCATTGGACATTAGA
TACTGTCTTTCCTTCAAAATGGCAACATAGGCATCTAAAATTAGGAATGCATATTTTCAA
TCAGTGTGTATATTGACTTATTTGTCTCTCCCAATTTTTAAAGCACAAGTTAAAGTTTAC
TAGGTCATCTAATTGTGTGCTGGCTCCTGAAGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved