Otolemur_garnettii Locus Mono:500:SNORA70
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:500:SNORA70
Otolemur_garnettii
Mono:500:SNORA70
GeneScaffold_2069
SNORA70
1001..1135
2135
GTCTCGACACAAAGAGCCACAGGCACAAAGCCTTTATTTCTTGCCCTCAACCATGACTA
TGGGGCCCAGCCTAGACATATGGGGACACGAGAGCTTGTCTGTGTGACAAGAAGAGATGA
ATCAAAGTATAATCTTTTTTGATATGTTTATTAACCTGAAAACCCTTTGGATTATGTTAG
TATTTACAAGGGCACTGTAGCAAAGAACCAGGGTCCAAGGCTTAGGGCCTGTGTGGATGC
TGACATCAAGCTGAGGCAGGTGTCACAGACAGATGCCAGGGAGAGCGGCCATCAGCTTAC
TGAGCAGGGTCACACAGGACACAGATCCTTGTTGCGGTGCACAGAGCCTGTCTGACCTGT
GCGCTTGTAGGGCTCATAATTTGATGTTGTTAGAACACACATGCTATGAGGGCAGAGGGT
CCACCTCCTATTAGCCACAGTCCCCAGGAAGGAGACACTCATTGTCAAGGTGCTCATTAC
AAATGGGAGATACTGCTTTGTAGTGATAAGGATCTGGTGCCTCTTACCAAAGTGTGTGGA
GGCCATGTTAATCATCAGTGGTTGTTGGCAGTCATACAGTGGGAACCAAGAGACATATTT
TCCAGACTGTGGAAAGGCATCATTGCCATGTCTACCCCACAACAAGAAACAATGTTCCCA
ATAACTAAGAAAATGACATGAAGGCTATGTTAACCAGTGTGATGAAAATATTTCAAATTG
TATATGAAAATACCACACTGTACCTCAGAATTGCATTAATGTACATAGTTATCATTTAAT
GAAAAAAAATAAGAATAAAAAAAAAGAAACAATGTTCCAGGAACCTGAGAGTCCCCCCAC
ACGGGCCCAGGGGTGGATAAACCAGGCCTTTGCGCCACACACTGATGCAGAATGGGCTCC
TCCATGCAGACAGGTTGATGACTACCACTCTTTCGATGGCCACCACTCTTTTGATGACCA
TTGTGCATGTTCCATGGTCTTGGGTGAAAAGCAAGAGACAACTGCAGCTAATTAAGCAAA
TCATGCTCCTTTCCTCATGGGGGTCTGGAGTGCAATGGCTGCAAATAGCAGCCTCCTATG
TAGTATATGCAGCCTGTTGCTTATATACGTTGCTCTAAGGGATCTCAGAGACATTCCTTT
CCAATACATGTTCATGTGTTAGACCTTGTGCTGTCCCCAATATAGGGTCCAAAGAGGTAT
TTGTGACCATGTGCTGTCCCCAATGTAGGGTCCAGACAGGTATGTATGACCATGTGCTGT
CCCCAATCTAGGGTCCAGACAGGTATGCTTGGTATCTTTGGAAAGCCCCAGGGCACTGTG
GCCAGAGTTCACATTGGCCAAGTCATCATGTCCCTCTGCACCAAACTATAGAACATGGAG
CATGTGACTGAGGCCCTTCGCAGGGCCAAGTTCAAGTTCTCTGGCCTCCAGAAGATTCAC
ATCTCCAGGAAATGGGATTTGTCCAAGTTAAATCAGATAAATTTGAAGACATGGTGTGTG
AGAGCAGCTCATCCCAGATATCTGTGGGGTCAAATACATCCCCAGTTGTGGCTCTGGACA
AAGTGTTCAGCCTTGTACTCATGAGAACGTATACTATCATTTGCACCTACCAAATGATAA
TTCCTACTTTCCTATCCGAAAATAAAAGAAAAAAAATAAAAAAAGCTAGAGAGAAAAAGA
CCCGGCTAAATTGATGGGCCTGTTGAGGAATCAGGGTGGTGGACATGGACAGGTCTAGAC
ACCCCAGAAACAGGGTACTCAGGAGTAGTCTCACAGCTTGGTCAGTCTGGTCCTAGACAC
CATCATAATTTCAAATTTCTCACTCAGGTTTCGAATGCCAATGAGTATCTAATTTTCAAG
CTAATGTCTGACCTCAGCCTAGAAGAGGCCCATACATGAGTCTTCCTAGATTGGCATCCA
TGAAAAGAGCTAATTCTTCAGTGGAACTCAGGGTACTTTTCAGAAGTGGAACTCAGTGCT
GGGCTGCTCCAAAGCAAAACAAGTCCACAGCAAGTTAATAAAGCCCACAAAGTAAAGACT
ATTGAGAGTACAGCTATAATAAAGAGAAGCTGGGCTCACTGGGACAGGGAGACACCCCCC
AGAGAAACCAGGTGCCCTGTGCTGAGGAGTCTGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved