Otolemur_garnettii Locus Mono:268:SNORA70
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:268:SNORA70
Otolemur_garnettii
Mono:268:SNORA70
scaffold_51254
SNORA70
1001..1113
1568
TGAATCATCTAAGTCCCTGTCAATTCATGAGTGCATAGAACTCCCATGGAGGTCCACTC
ATCCATAAAAAGGAAAGAAGTAATGTTTACAGAAACTTGGATGGAACTGGAGACCATTAT
CCTAAGTATCTCAAGAATGGAAAACCAAACACTATATGACCTTATTAGTAAATAGGAGCT
GAACAAGGAGTGTATACACAGACACAAAGAGATATAAAGGACATTAGAAAAACAGAGGGG
AGAGGCTGAGAAAGGGGTATGAGGGATGAAAACTAACCTATTAGGTTTAATGAACACTAT
TCTGGTGATGAGCATAAAAGCCCTGACTTAAGCATTATTCAAGGTATCTGCATAATGAAA
ACATCTGTATCCCCTTAATATTTTGAATTTAAAAAAAACCAGACTTACTGTAAAGGTACA
ATAATCAAGATGGTGTGACGTTTATAAAAAAATAGACAAAAAGGCTCAGTGTCTGTAGCT
CAAGCAGCTAGCGCACAAGCCACATACACCAGAGCTGGCAGGTTCAAATCCAGCCCAGCC
CACCAAACAATGACAACTACAACCAAAAAATAGCTGGGCGTTGTGGCAGGCAGCTGTAGC
CCAGCTACTTGGAAGGCTGAGGCAAGAGAATCACTTAAGCCCAAGAGTTAGAGGTTGCTG
TGAGCTGTGATGTCACTGCACTCTACCCAGGGTGACAGCTTGAGACTGTCTCAAATAGGT
CAACGAAACACAAAAGAGACCTCAGACTCACATAAATACAGTCAAAGGAGTAATCATAAT
TTTTGACAAAGGAGCCTGGAGCAAGAAAGTGACCCTCTGTCTGTCTTAGAAAAAAAAAAA
AAAGCCCCATTTCTTGGAGATGTGAATCTTTTGGTAGCCAGGGAACTCTGCAAAAGATAC
TGTCAGGAGTATGAAAAGAAAAGTGAAGGTTGGGGAGAAAATATTTTAAAGGACTACTAT
CTAAAATGTATAAAAAAAATTCTTAAAACTCTAATAGGATCCTGCAGCTAATTAGCTGAC
AATGCTCCTTTCCTCTGGGGCCAGGTGTGCAATGGCCTCCTTGGTAGCATCCTGTTGCTT
GTATAGGTTGCTCTAAAGGACCTGGGAGACATTCCTTTCCAATACACACTCATGTGTTAA
GACTTTGTGCTGTTCCCAGTCTAGGCTCCAGACAAGTCTGCCTTTGGAAAACTCCAGGGC
ACTGTTGCCAGGGTTCACACTGGCCAAGGCATCATGTCCATCAGCACCATACTATAGAAT
AAGGAGCCTGTGATTGAGGTCCTAAGCAGCCAAGTTCAAGTTCCCTGGCCGCTAAAAGAT
CCACATCTCTAAGAAGTGGGGCTTTACCAAGTTTAATGCAAATGAATCTGAAGACCTGAT
GAGTGGCTGAGAAGCAGCTCATCCCAGATGGCTGTGGGGTCAGATATATCCCTAATAATC
GTGGCCACCTGGACAAGTGGCGGGCCCTGTACTCATGAGGACTTACACTATGCTGCTTCT
CATTTGTGCCTACCAATAATAAAGTCTACTTCCTGTCCAAAAAAAAAAAAAGAAAACCTT
AATAAGAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved