Otolemur_garnettii Locus Mono:215:SNORD115
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:215:SNORD115
Otolemur_garnettii
Mono:215:SNORD115
scaffold_73951
SNORD115
1001..1083
2083
GCTGAGCTCGCGCTCCCCCTCTTTGTGTATTTCAGGGAGCTGTTCTGCCCAGGTTTGAC
CCTTCGGCTGGCAAGATGGCAGGTGAGTGGATGGCCTGGGGCGTCCGCCCTGTCCAGCGG
GGCATGGGTGTGGGGGGCCGAGGTTCAGCCTGATGGCAAAGAGCGCCTCCCGCCGGAAAG
CCCATGGGGAAGTGGAACGCGGACTCCCTCTTCTGGGGGAAGCTCCCTGGGAACCGGGAC
GCCCCCGCAGGGCAGGGCGCATGTCCTTGTCAGTGGCGTGGGTCCGGGTCACCCAGGGCC
CCAAGGGGCCCTTGTCGGAGGCCGAGGGCCACGCACAGGTCAGTGTAGGTCTCGCCCCTC
GGGCGGCCGGGGCGCGAGATGGGGCTGGGGCGTCCCGAGGCCGGGAGTGGCCGGCTGAAT
GCCGGGCAGCTCCAGGTGGGAACGCTCAGGGTCCACTGACAGGTCCCGGCGAAGTTGGCC
AGGGTTGGCCGGGAGGCCAGAGGCCACCTCCAGCGGTGGGAGGGAGTCGGGCCCCAGAAA
GGAGGGGCCGTGCGGCCCCGGGCCCCCACTGGCCCAGGTGGGTGTGCCTTTGGGTCGGGA
CTGTGCAGCCAGTCACCTGAGGGAGGCTCCAGGACTCCAGGGGCAGCGCATCTGGTCCCT
GCTCCGGATCCGCCCTGGGGTCCCCGCAGCCCCTGCCAGCGAGGGCCAGCCCCCTCCCCC
ACCCCAGGAGGCTCCAGAGTCTCGGTGGACCCAGACTGTCCTCCTCTTCCTCCTCCTCCT
CCACCTCCTCCTCCTCCTCGTCCCACTCCCCCCGCAGACAGACACACGTCCCGTCCCTCG
GGCCCGGTGTGGCTGGGCAGTGGCTCTCAAGCAGGTGGCCAGCATGCACTCCGCGGAAAC
TCCTGTCCCCCGTGGCCCCGCGGCCTCCCGCCTTGAGCTGTGGTGAGCTTCTCCACCTCC
AGCCCCACCTCCGCGCGGGAAGGGAGGGGTGGCCATGGCCTGGGTCGATGATGACAACCT
AACTCTGAAGAGAGGTGATGAATAAAAAAAAAAAATTGTACACCAGAGGATTGAGCTGAG
GCCCAGCCTAGGTGAGCAGAAGAGGACGCAGGGATGTTGGTGTCCCGGGACGGGCGACTG
TGGCTTAGGCCAGAGCCCTGGACGCCCTGGAGGGCATCTCGGGGGGCGCCCACCCCACCC
CCATCTTGTCTGTGCGCTCCTCAGTGGGCACCCCAAGCTCCACGCGGCGGGCTGGGTGTC
GGGGATCCATTTCCCCCGGGGCAGTCCACGGGGGGCGGCTCCTTGCTGAGCTCGCGCTCC
CCCCCCATCCTGTATTTCAGAGAGCCGGTCTGCCCAGGATGGCCCTCCGGCAGGGAGGAT
GGCAGGTGAGTGCTTGGCTTGGGGCGTCAGCTGTGACCAGGAAAGCCGGGAAGGGCCTTG
CGGTGGGGGCTGGGGGGCGGTGGGCCGAGGTCCAGCCTGAGGCCGCCCCGACGCTCCCAG
GTTGGTGCCATGTGGAGACCTGAGGGAGAAGCCTGGACTCCAGGGCACAGCGGCCCAGCT
CAGGGCCACAGGCTCTGTCTCCATGGGGGTGGGGCGCTCGGGGAGAGGCGGCCCCGAGTC
CGGGTATCTGATTGGGGCTGTGGGGATGCCCCTGGCTTCCCGGTGACGGGCCTCGGTCGC
CAGTGAGGTCACGGGCGACGCTGACACTGCCGCCCTGGCGTGCGTCTCGGCACCAAGGAG
CGGCCACATGCTCCTGCTCAGTGGGCTGGCCGCAGGACGCAGCCCTCCTGGTCTGGCCCA
AGCCCAGTCAGCCCTCTGGGGTAGGGTCCTCTGGGGCCCTGCCGGAGCCAGGGTCCCAAG
AGGAACGCGTCTGGCCCCTAGAGCGCATCCGTCCTGGGGGTCCCCGAAGGGCGTGCCAGC
GCGGCTCAGCCGCCGCCCCCACCCGGAGAGTGCTCGAAGCTTTGGGGACTTGGGGACTGA
CCCCTGTCTTCGGCCTCTCAACGCTCCGGAGACAAATCCCAAGAGACAGAGTCCCCTCCC
TGGGCCCGCTGCGGCGGACAGGGCTGTCACCAGGAGCCAGCATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved