Otolemur_garnettii Locus Mono:188:SNORA62
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:188:SNORA62
Otolemur_garnettii
Mono:188:SNORA62
scaffold_55672
SNORA62
1001..1152
2152
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGCATGGTATGTTAACCTGCCTGCCATTGCTCTGTATAACACAGAT
TCTCCTCTGTGTTCTGTGGACATCACCATCCCATGCAACAACAAGGTAATGAGTTTATGA
TTAGAGTTTCCAAATAAGTCTCTAGAAAAAATAGGTATTCCTGTGTACCTTGTTAGAGTT
TGGAGATTAGGCCACTGATGGCTGATGCACTCACTAGTGTAGGTAGTCTGCTGCATGAGA
GGCAAGTTTTCCCTAATATCACAAGGGTCTCTGGCCCAATGAGTGGAGTTTTATAGTAAT
CCTTGATACAAGTATTTAAAAAAAAAAAAGAGTACCAAGAACATGACAAAGAATACAAAA
AATAATGTACCCCAGTAGAAACATTGGGTGAACAAAAATTTTAATCACTGTGAATGATAT
ATCGAGGTATGATCACAGTTGACAAAGAAAAAGGATAGCCATAAAAAAGGCAACATTGTG
ACTTTTTATGAATATGGAATAAATGGTAGAAAAGGAAATATGGCTGACAATCAAGTTCAT
GATTTTAAAAATGAATGTAAGGTGTTGAAATAAAAACTGACACACAAAATTTGAGAGAAA
ACTCATGAAAGATCCTAAAAGTCTGAAATATATTTAACAATGTTTCCAAAAGGAAAAAGT
AAAAATGATAGAGAGAGAGACCAATCAGAATCTAAGGACTATTTGTAACTTGGAGAGGTT
TTAGAGTGAAAATGTGGAGAATTTGTGAGAAGGATAATAAAAACCAATACCTAGACACAA
CATTGTGAAATGAATCATAAGGACAAAGAAAAATTCTGAAAACTTCTATAGAGAAATAAA
AGTTACCTACACAGGAGAAGGTATTCATTAAACACTTCCACTATCTAGTGTATAGCCTGC
AGGAAATAGTTGAGGTGTTCTTTTTTTTTTTTTGGTCAGTTTTTGGCCAGGGCTGGGTTT
GACCCCACCACCTCCGGTATATAGGGCCAGCACCCTACTCCTATGATCCACAGGCACCGC
CCAGGAAATAGCTGAGTTTTTACCTTCCCTCTCCATCTCCCCACCGCTAACTCTATTTGT
CTTTAAGAAACAGGATGCCTGCAGAGCTCCCCCTCTTGAGTAAACCAGCTGAAACCAGTG
TGACCAAAAGGGCAGCTCAATAGACCTCTAAAGAACCTTTAACTTCATTATGATCTAATT
TCTACATTAAGGTGGTGTTCCGATTCTGAGTTCCACATCCATTCCCAGGAAAGACATGAA
TATTTTACCTTCTGCTTTTAATACCAAACCCTTTCATTTAAAGAAATCCTATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved