Otolemur_garnettii Locus Mono:21:SNORA25
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:21:SNORA25
Otolemur_garnettii
Mono:21:SNORA25
scaffold_90106
SNORA25
1001..1121
2121
TTCTTTGAGAAAAATCAAAGGCTGTGGAGTGACATGAGGGTTGGAAGAAAAGGGAGGGC
AACTAAAACCCTGGTACTTACAGCTGCCTGGTGATCTTTCCCCTCGGTAGGAAACACAAA
GACTGTTGGCTTGGTTTTAATCAGCCCAAATCCTACCTACTGTAAGGTAATCGATAGCCT
GGCATTTTCTGATTACATAGTAAGTATCAAAGACTAATGAATCTAATCTTATGGTTCACT
TCATAGTTAACCTTCAGTGAAACTCAGTGTCTGGGTACTGTTCAGTATTAAGGTCTATCA
GACCATGAAAGGGCACGTGAAACCTTCTGTGCATATCACTAAAAGAAGCCGGTGTGAAAA
AGCTACGTAACTGATTCTGTTATTCAGCTGGCAAGATTTTTCTACAGTAGACCACTGTCT
CCTCGGCTTCTCTGTATGCTAACACTTCACGGTACATCCTTCACAGGTCTACTAAGCCGC
ACGGTTCGCCCATAACTCCTAGTTTCACGTACAGCAGTTTCCCTTTAGATTCTCCCCCAT
TGCCCTGTCCTTAAGTTCAAGAACTTCCTCACGATATCCGGCTGTTAATCTCATGGCTGT
AACTGTCATCCTACACACTAAGATTTCCTTAGTCTTTTCAGAGATGGTACCTAGCCTTGT
GCCCAGGGTAGAGTGCAGTGGTGTAATCACAGCTCACTGCAACCTCAAACTCCGGGGCTC
ACGTGATCCTCCTGCCTCAGCCTCCTGTGTGGCTAGCACTACAGCTCCACACCACTATTC
TCTGCTGACTTCTTCCATTTAGAGATGAGGTCTTGCTATCTTGCCCAGGCTGGCCTTAAG
CAATCCTTCACCTCAGCCTTGCTATGTGTTGGGCTTTCAGGCATGTGCTGCCATGCCTGG
CCCCCTCTAAAAGCTTCTGGATCTCTTTACACCATGCGTGTCCTAACTACTAGAACACAT
GGACAGTGATAATTGGACACAGAAGAATTTTGTATAACCGTTGGTCATTTCAGAGATGGC
TTGTGGGGCTGTAAAATCAGGAGCTTTTAGAGCTGACCAAAGATCGTAGTTTTGAGAGTT
GCTAGTCACTCAGTAGTGCTGGGTTTTCCTAAGGAAACAATACTTAAGGCTCTCTCCACA
TTTCCCATAGTTACACTATTTTCTTAAACTTGACTTAATTTGTATCTTTCTCACACACTG
TGTAAGTATTAACAAGGAAGTATTCTCTGCATCTGTTCACACACGGCACTTTCCCTCTAC
CTTGGACGTGTGAAAGATGAGTCCTCAGTGTATTCTCATTGAATGTTGAGTTGACCTTTT
CCTAACTCTGATTTTGAATCCAGATTCAAACTAAGACAGTTGAAGAAAAGCACCCTTGCT
TCTTCCAACAGCCTCACGTTAGAATTGCACCCTTGTGGGTAAACGGCACACAGTGGGATT
TTGCAGTCTGAGCTGTGGTGCCCTCCCCCTCCTGATCACACACTACCTCCGGAGCACATC
TCCCCCCGGTGTGGGACCAGCATTTCTATCTGGTGCCAGCCCACAAATGAAACCGTAGGA
GAGTGAGGACAGGGAGGGAAGCCAGTTTGCTTCTCCTCATCACGGCTTAGATCTCAGTCT
AAATCTCCACAGCTTCAGCTTCAGACAGTACAACTACACTGTCAGTTGCCAGCAGGGGGA
TACTACCCTTGGATGCCAGTATTGTCACCTGATTCACCTGTCCAGTCACCCTGGGGGTGG
TCTCCAATGGGCCCTGTTCTGGAGGCAAAGCACAATGTCCACAGACGCTCAGCCCGCAGT
GCCAGTCTTATCAGGGCTGAGTGAGTGTGGGGCTTTCTTGTCCGTGTGAATCTGCCAGGT
GGTGGGGAGCTCACAGCTCATCCATGTGTCCCGGTGAGGTCTTTCATCCCCTCCGTGTGG
GTAAAATGAGAACCAGGACAAGGGCTTCCTATCTAAAAACAATACCTTGTCTCTGAACCT
ATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved