Otolemur_garnettii Locus Mono:485:SNORA70
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:485:SNORA70
Otolemur_garnettii
Mono:485:SNORA70
GeneScaffold_3683
SNORA70
1001..1136
2136
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGTTGAACAAATAAGACTTAAAC
ATTACCAGTGAAAAAGGCTAGGTATAGTGGCTCATGCCTGTAATATCAGCATTTTGGAGG
CTGAGGTGGGAAGATTGTTTGAGGCCAGGAGTTTAAAACCAGCCTGGGCAACACAGCGAG
ACCTCATCTCTTTTTTTTTTTTGGACAGAGTCTCACTTTGTTACCCCTAGTAGAGTGCTA
TGGTGTCGTAGCTCACAGCAACTTCAAGCTCTTGGGCTTAATCAACACTTTTTTTTTTGA
GACAGAGTGTCACTATGTCGCCCTTGGTAGAGTGCTGTAGTGTTACAGCTTACAGCAACC
TCAAACTCAGGTCTAAGCAATTCTCTTGCGTCAGCCTCCCTGGTAGCTGGGACTATAGGC
ACCCGCCACAATGCCCAGCTATTTTGGTTGCAGTCGTCTTTGTTGTTTAGCAGATCTGGG
CTGGGTTCAAACCCGCCAGCCTTGGTGGATGTGGCTGGCACCCTACTCACTGAGCTACGG
ACAACAAGCCTCAAACTATACTCTTGCCACAGCTTTCTGAGTAGCTGGGACTACAGTTAC
CTGCCACAGCACCTGGCTATTTTTACAGATGGGATCTCACTTTTGTTCAGGTTGTTCTCA
AATCTGTAAACCCCTTCAATCTACCCACCTCAAACTCCCAGAGTGCTAGGATTACAGGCA
TGAGCCACCATGCCTGGCCAAGACCCCATCTCTGAGGAAAAAAAAAATAAGTAAAGCTGA
CGACGCTCCTTTCCTCATGGGGCCCTGGTGTGCAATGGCTGCAAACAGTAGTCTCTTTGG
TATGTGTATGCAGCCTGTTGCTTGTATAGGTTGTTCTAAGGTACCTTAGAGACATTCCTG
ATACATGTTCATGTGACCTGTGCTGTCCCCAATTGAGGCTCTAGACAGGTATACGTGGTG
CCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGATTAAGTCATTATGTCCA
TCTACAGCAAATTACAGAACAAGGAGCTTGTGATTGAGGCCCTTCTCAGGGTCAAGTTCA
AGTTTCCTGGCCTCCAGATTCACATCTCCAGAAAAATGGGGTTTTACCAAGTTTATCTCA
GATAAATTTGAAGACACGGTGCTGAGCAGCAGCTCTAGTTCATACCAAATGGCTGTGGGG
TCAAATATAGTCCCAATTGTGGGCCCCTGGAAAAGTGGCACGCCCTGCACTCATGAGGAC
TTACACTGTGTTGCCTATCATTTGCACCTACCAATAATAAATCCTACTTCCTGTCCAATA
TATATATAAAAATCAGCTGGGCAGCACCCGTGGCTCAAAGGAGTAGGGCGCTCGCCCCAT
ATGCCAAAGGTGGCGGGTTCAAACCCAGCCCTGGCCAGAAACTACAAAAAAAAAAAAAAT
TAGCTGAGTGTGGTGGTACACATCTATAGTCCTAGCTACAGAGGAAGCTGAGGTGGGAGG
ATCACTTGAGCCCAGAATTGTAAGGCTGAAATGAGCTATAATTGCAGTACTATATTCTAG
CCTCTGGGCAACAGAGTGAGACCCATGTCTTTAAAAACAATCAGTTACCAAAGAAAAAAG
TATTGCCTACAAAAGAAAAAAATTATAGCCTTAGAATTTATATTTACAACTCATGAAACA
GTCACTTTAATTCATTAAGAATTAGAATTGGGGCTGGGCACAGTGGCTCAAGCTGATAAT
TAGCCTGAGCACAAGTGAGACCCTGTTTCTTTAAAACACACACACACACACACACACACA
CACGTCAGGTGTAGTAGCAGCACACCTGTAGTCCCAGCTCAGCTATTCAGGAGGCTGAGT
CATGAGGATTGCTCAAGCCTAAGAGTTTGAAGCTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved