Otolemur_garnettii Locus Mono:63:SNORA33
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:63:SNORA33
Otolemur_garnettii
Mono:63:SNORA33
scaffold_98797
SNORA33
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTTGAGCCA
CAGGCGCTGAGCCTATCCTCAATTTTCAGGGGGAAAAAAATCCTAAAGTTCGTAGTATTT
TTAACATAAAACTCAAGTAGGAAAAAATTCTAAGCCAGAAGCATATCACCGTGTCTCTTC
TTTAGAAGCAGGCACTCTTTCTAGTTCCTGAAACAGTAGTGAATTGAATTAAGAAATAAA
TTCACTAATCCAAGTATGCAACTAGAAGAGAATATGAGGCTAATAGTAATTGTCTTTGGA
TTAAAAAAATGTGTTTCTGCAGAAATTTTAAAAAAGCTGGCAATAGCCAGGCCATGTTCT
GAGCCTTATGGACACTGAAGTCATTAAGGTCCCTGAAAATGGCCTTAACAAATTTTAGTA
ATGTGACACATTTTCATAAGGCATAGTTAATTATTAAAGCTTGTTTGTGAGTAATGCTTA
TGAACTTAGTGGAGTTGCTAAATGCTAATGAGAAACTGCATATAACTTTTTTTTTTTTAG
GATTATGGCAAAGAATCTCAGGCCAAGGATGTCATTGAAGAGTACTTTAAATGCAAGAAA
TGGGGGGTGGTGCCCGTGGCTCAGTGAGTAGCGCACTGACCCCATATACCAAAGGTGGCG
GGTTCGAACCTGGCCCCGGCCAAACTGCCACAAAAAATAGCCAGGCATTGTGGTGGGCAC
CTATAGTCCTAGCTACCTGGGAGGCTTAAACAACAGAATCACCTGAGTCCAGGAGCTAAA
GGTTGCTGTGAGCTGTGATGCTATTGCACTCTAACAAGGGCAACAAAGTAAGATTGTGTC
TCAAAAAAAAAGCAAGAAATGAATAAATAAAACTTTGGCTCATGTTCCTTAAAAAAAAAA
AATAAATGTGATTTTAAAATAGAATCTTCTGCCTTTTCTGAGGCTTTTATGTATACATAT
TACTTTTATAAGAAAAACTGAAATTTCTTTGAAAAAGGAATTCTTCACTTTTAGATCTGA
AAGTTTCATTGCATTATCAAATATTTATGACTATAAAATATACCAAATTTGTATTACTGT
ACTTTATTAATGTAACTTCACAATCAGATTTGTGTATCCCTTTTCTTATACTTACCTTTT
GAAGGTTCTAAGGGTAAGTTAGGAAATGACAATGAAGCCTGTCAACCAAGAATTCTAGAA
GTGATTCTTAAATTCCTTTTTAATATTGCTTTGAAAACTTGAGTAAGCTGAGGATGGTGG
CTCCTAGCACTCCGGGTGGGTGAACTGCCTGAGTTCATGGGATGCAGACCAGCCTGAGCA
AGATCAAAACTCCGTCTTTAAAAAAATAGCTGGGCATTGTGGTGGGCACCAGTAAGTCCA
GCTACTTGGGAGGCTAAGGCAAGAGAACTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved