Otolemur_garnettii Locus Poly:14:SNORA44
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:14:SNORA44
Otolemur_garnettii
Poly:14:SNORA44
GeneScaffold_4629
SNORA16, SNORA44
1001..1135, 1806..1937
2478
GGTTGCTGTGAGCTGTGACGCCATGGCACTTTACTGAGGGTGACAAAGTGAGACTCTGT
CTCAAAAAATAAATAAAATACGGCTCGTCGCCGGTAGCACAATTATTAAAGCGCCACCCA
CATACATCGAGGCTGGGTTCGAACCCGGCTTGGGCCAGCTAAAACAACAACAGCTGCAAT
TAAAATAGCCAGGTGTTGTGGCGGCCCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAA
AAGACTAACTTAAGCACGAGAGTCGGAGGTTGCTGTGAGCTATGATGCCACAGCACTACC
AAGGGCGACATAGTGAGAATGTCTCTCAAAAAAAAAAATTAGAAATACAATAGGGATAAA
ATGATGCCAAGAAGATTAAGAAAAAGCACAGACTAGCACAAGATAAAATAGTAGTTGTTG
GGACCTACAGGATGGCTTTGCTTTTTTGGCCACTAGAGTGTCCGTTAAAATGTATTTCAG
TAAAAATAATGCACAAAATTTAGGGGATCACCTGGCTAGGTAGTAGTGGTTTGTGATTGC
CCTGTGGCCCTTATCGAAGCTGCAGCTGCTTCCATATAGCTGCTGTGGTCAAAGAGGAGC
CTAGAGTGACAGTTTTCCTTGACGGTCGCCGTTCTGTTTGCTGTAACTGATCTGCAACAT
TTTGGGAAAATACAGTTTTTGTACCTGCCATTTCTTGGATCTAGCCAGAGACCTTCATTG
AGCTTGGCATGTTCCCACAAAACAGCAGAAAAGGCTTGGCGCCTGTAGCTAAGGCGCCAG
CCACATACACCTAAGGTGGCTGGTTCAAATCCAGCCCGGCCCGCCAAACGACGATGATGG
CTGCAACCCAAAAAAATAGCCAGGCGTTGTGGCGGGTGCCTGTGGTCCCAGCTACCTAGG
AGGCTGAGGCAGGAGACTCGCTTGAGCCCAGGAGTTGGAGGTTGAAGTAGCTAGGTGAGA
CTAAGAACCAACATGGAGAGTGGAGAGGCAGTTGGTAGTAGTTTGAAAGACAATCCAGTG
GCATGTGACACAGATCATACATAACAGTGCATGGTTCACTTAACTGCAGAGTTTAATGGG
TCAGTATCAGGACCAAAGGTAAGTCGGACCTGATTCTGAGGACAAAATGAAGGGAACATT
GAGATCAATTCAGGATAATTGTGTTCTCATTTAAGCTTGTGCAAGATGAAGATTCCAAGA
ATGGCTGAAGTTGATTTTTCTGGAGAGTGAAGCCTCTTGGGCCTCATAAACTGAATCAAA
CAGAAACATTCTCAGGGACACCTGTGTAGGTTTGCTTCTGAACACTTACCTTTGGGAGCT
ACGGAGGGCAGTTGGGGAACAGTGCTGCATTGTTTTCCAAGGAATGTGGCTGGTTGTTGC
CATTGGATCCTCCACCTGCATGCAAGAACAATTGTGGAGAGACTTTGACAGCTTAAGTCA
GTACAGTACCTGTAGCTGCCACTTCACCTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved