Otolemur_garnettii Locus Mono:345:SNORA75
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:345:SNORA75
Otolemur_garnettii
Mono:345:SNORA75
GeneScaffold_4004
SNORA75
1001..1121
2121
AGGGAGGCTAGCAGAGCTAAGAAAAAAAAATTAAGAACTAAATAATGATATAATAAAAA
TTGGCTCGGCACCTGTGGCTCAAGTGGCCAAAGCACCAGCCACATACACCTAAGGTGGTG
GGTTCGAATCCAGCCTGGGCCCACCAAACAACAGTGACGGCTGCAACCAAAAAACAACCA
GGCGTTGTTGGCCTGGCACCTGTGGTCCCAGCTACTTGGGAGGCAGAGGCAAGAGACTCG
CTTGAACCCAAGAGTTGGAGGTTGCTGTGAGCTATGATGCCATGGCATTCTACCCAGGGG
GACAGCTTGAGGCTCTGTCTCAAAAAAAAAAAAAAAATAGATATAATAAAAATTAAAAAG
TTATTGCAACACAGAGCAGAAAAGATAATTTAGAAAAACCCTATCAGCCAAATGGAAGAC
AAACTTTAGAAAAATCACGGACCTGAGGGAAGGGGGTGGGGACTAGGAGGAAATAGGCAA
AGAAAATATGACAGAAAATACAACAGACGTGCAGAGGAAAAAAAGGAAAGCTAATGAACA
GCAGATGCTCTCAAAGACAGAAAAAAGAACAAATGGAATAGGAAAAAAATTAAGGAAGGC
AATTTTCTATAAATTAAGAAAGATGTGCATCAGTAGATAAAAGGGACTCACACTATATAC
CAGGAAAATTTTCAAAATTTCAAAATAACCTAGAGAAGTTACTAAACTTCAAGGTAAAAG
AATCTTACAAGCCAGAATTGAGCAAACTATGAGCCAGCAGGCCAAACTGCCATCTGTTTT
TGTATATAAAGTTTTATTGGCACACAGCAAAGCCCATTCATTTACACATGGGCTTTTGTG
TCACAACTGCAGAGTTAAGTGTTTGCTGTAGAGACCATATGGCCTACAAACCCTAAAATA
TTTATAGTCACTTTACAGAAAATGTTTGCCAATCCCTGTTAGAACTATTAGAGAAAAGAA
ACAAGCTATGTACAAAGGAAAAAACAAGCAGGCCAATCTCACACTTTTCAGCAGAACATA
CATGGCACTGGATTCACATGAGAAGAAGAGAGAATTTACAGAACTACCATTATTTTACCT
TCTGTCTCTACAGTGGTATCTTGGCTGCTCTGTGAGACATTCTGGGGAAAAGAATAAAAA
GAATATAGGTGGCAGAAGACAAGGAAGCAATGTTTATAGAATTGTGAAGGGAAAAGAGTG
TGACTAAGAATTTCAGGAGCAGTTATTGTTTTCTGTATGTAAAAACAACAGACATTCTTA
ACTATATGAATACCACAGATATATATATATAATGCCCCAGCCCTTCTTGAAGAAAAATAA
ATCTGCTTGAAAACAGAATCCCACGCTCACTAAAAGGCGGCTCAAAATAAAGAATTAACA
ACCAGGAAAAAATGTGGGATGAAAAGTCTGGAAAAGAGTACTAGACTGAATCCATTTAAC
CATGACATTAAACATATGTAACCATGACGATTACTGCTTAGAAAACAAAACATAATGCAT
AGGCTGGGCACAGTAACAATAAAATTATTATGTTTATAATCCCAGCACCTTGGGAGGCCA
CGGCAGGAGTATCACTTGAGGTCTCAAATTCAAGACCAGCCTGAGCAATATAGGGAGACC
CCATCTGTACAAAAAATTAAAAAATTAGCTGAGCATGTTGGCCCATGCCTGTAACTGGGG
CTACTCAGGAGACTGAAGCAGGAGGTTTATTTGAGTCTAGGAGTTTGAGAATGCAGTAAG
CTCTGATGATCCCACCACACTCTAGCCAGGGAGAAAGAGTAAGACTCTGTCTCCAAAAAA
AAAAAAGAAAGAAAGAAAAGATTAGATCAAAAACCAAAATTCAATTAACTATATATACCA
ATTGTAATAGGAAAAGCTAAAATAGAAAGTCTCAGAAAGTCTGAAGGTTAAAAAGGGAAA
AAAATATATACTAAAGCATATACAAACAAAAAAAGAAAGCAGAGATTATAGTATTANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved