Otolemur_garnettii Locus Mono:260:SNORA2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:260:SNORA2
Otolemur_garnettii
Mono:260:SNORA2
scaffold_98976
SNORA2
1001..1137
2137
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
AAAACAATGTAAGATCCTGTTTGGGTGGTGTAAACATTTTTTAATATGGTGTGTATGTAT
CACACATCACAAACTGAAAAAGGAGAAACCAATGTATACATTGAGTTGTCATTATTTGTT
TATAATTAATTTTTCCCCAAATTATATTTACCTATTTTACTTTAAGATATCTACTTCTCC
ATGTTTGTTGAAATAGTCAAATACTTTTTGATTGATCCTGTTTTCTACAGGAGACAGTAA
TCTTCTTTTTAAAAAGTAGACTGTTCTTTCTAATCAGTGATGAAATGTGCTCTAATAATG
TTCTTTGAAAAAATAATGCAAAATATTTAAAGAAGAAAGTAGCAAAGCAGTTGTGGCTTC
GTTCTTTTCTAGTCATTATTTTTAGATTTTCAGATGTTGGCTCGCCTGTGACATTACTTA
TGAAGAATACATGGTAATTTGCTTTCTAGTTACACATGAGTAAACTATCAGACCTAACCA
TTGTGCTGCTAAAGTAATCTAGCTTGTTCCTGTTAAGCATAAATTAGGCAGGCCCAGGTA
ATTGGGCAATTAACATTAAGGAAAATGTGGCTTAAAGAGATTCTCCACATTCAGTTCAAA
TCAGCATAAAATATTGTTAATTCAACATTAAAATGTACTTCTATTTTGTTTAAATACTAA
GTTTTGTATTGATCCTTGGTGGATCTAGGGCTCATTTTTCTTAATATCTTGCCAACACTG
TTTTTTTGTTTGGATGAAACAACATTAAATGTTAAGTTTGGTTGGCCCTGAATCAAGGCC
AGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGTGCCTAAAGAATTATCTTTCTATGGTC
TGTTGGCTATTTCAGAACTTTGGAAATGTAATGGTCAATTCATTAGAAAGAAACAGTATG
AGTTATTGGTGATAGATGTAGGCTAGTATATATTTGTAGTCTTAATACTGGGGTTCCAAA
ATATCTATAAAATATTATTATATTTATCTCAAGAGGATATTTAAGTTATTCGTTAGAATT
ATAGTGCTGTTAAATCTTAATTACAGCCCCCCAAAATTACTGTGGGTTTTTACCCAAAAT
AAAAATATAATTCTATAGTATGAAAAAAAAATGTTAAGTTTGGTTTCTTTATCTACAACT
CACATTTCTAATTGTAACAAGCGTTTTTAACAACAACCTAGAAAATTTAAAAATCTAAAA
CAGATCCTAGGCACTGGAGGAAATGAAACTATTTTCATGAAGATAATATAAACTTTGACT
AAATTCTCCACTATTGTAACATGGTGCTCTTATTATTTGGTTGAGCTTTTTTAATGGTAC
ATTAAATCTGAATTGTTATACATGATTCATATTCTTCTAATGCTTAAAATAATTGGCATA
TAAATGTATACCTACAGTGTGTATTATTTTCTATGTGTAATTTTCTGATTCTGTAACTTA
AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved