Otolemur_garnettii Locus Mono:86:SNORA71
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:86:SNORA71
Otolemur_garnettii
Mono:86:SNORA71
scaffold_102472
SNORA71
1001..1137
2137
TACTCAACATCATTGGGCAGAGCCTATGGCTCAAGGAGTAGGGCACTGGCCCCATATAC
CAGAGGTGGTGGGTTCAAACCTGGCCCTAGCCAAAAATTGCAAAAAAAAAAGCTCAGCAT
CACTAATCATCAGGGAAATGCAAATTACAACTACAATGAAATACCACCTTACCCTATCAG
AATGGCCATTATTAGAAAGTTGATAATAGATGCCAGTCTCGATGGAGAAAGGAATGCTTA
TACATCATTGGTGAGACTGCAAATTCCATAACCTCTATGGAAAACAGTATGGTGATTCCT
TAAAGAAATAAATTAGACCTACCATTTGATCAAAGGAAATTAAGTCATTTTATCTGAAAG
ACGTCCGTTCTCGAATGTTTATCACAGCACAATTCACAATTGCAAGGATGTGGAATCAAC
CTAAGTGCCCTTCAATTCATGAGCAGATAAAGAAAATGTGATGTATATACACCATGGTGT
ACCACTCAGCTATAAAAAGGAATGGAATAAGGCACATCTGGCCATTTGGATGGAACTGGA
GACCGTTATCCTAAGTGAAGGGTCTCAGGAATAGAAAGTCAAACACCTTATACTCTTACT
AATAAGTGGGAGCTAATAGATGGGTACACGCAAATACAAAGCCACATACAGGCCACCAGA
AACCCAAAAGGGGGAAGGGTAGGCAGGTGGATGTGGGATGTAAATTTACCTGTGGCATAC
GATGAACAGTATTCTGGTGATGGGCCCATGCAAAGTCCTGACTTCAGTGTTATCTGACCC
TTGTCATTAATATTTAGGGAAAATAACTAACTAAATAAATAGGGTCATTTGACCTGTAGA
ATTTCGCATGTTAAAAAAAGAAAAAGTGCAAAAAATGTAAGGAAAACAGCAACAACACCG
TACGAGGTTTATAACATATGTAGAACTGTATGACTATATTTTGAAGTTTTGAAAATATTG
GTGTAACGTTATGTATCATATCCTTTAGTTAAAATGAATTCCCCTGCTTTCCAAAGGGAT
CATGGGCTTCCCGTGCCCTGTCACTGATAGTGTGGGGAGAGGAACTGATGAACGCCATTT
CCCCATGTTTGCAAGGTCCATTCCTGTCTCTTCCAAACCCTGGAGCCGCCTTCCCCCCAC
CACCTTCCAGATGCCCGGCGTCGTCTAGTTTGTTGAGTTGCTCTTCTCCCCAGCCCGGAG
CACACTGCTGTGAGACACCCAGGAAGGGTGCGGGACCACAGTTGGGCGGGAAGGAGTAGG
AAAGCTGGGCGTGTAGCTGTGATGGGGCACAGAGGCTTCCTCGACCTCCACACCTTTTCT
TAGTCACGCCCCTCAGCACCGAGCAGACCCGGTGGAAATTGTTGCTCGACTTGTCTCCTG
AGCTCACTTTGCTGTGATCTTGCGGGCAGTGTCTCAGTGCTCCATCAGTGTGACACAAAT
GAAGACAAAGAGAGAGTCCCGCCATTCATCGCCCTGCGGACTGGAATGCGATGTGGGAAA
ATGCTGAGTAAGCAACCCGTGCAGGGGTGGAGGGTAGGAGCAGATCTGATATTTTCCACC
CCTTCACAGAACTGGTCAACAAGTGACTTAGTTCAGTTGGTCCTGGCCCTGTGTGGCCAC
TGGGGAAGGATTTTCCCTCCGGTCTAGGTAAGGAGACAAGGACTGGAGATGGCCAGAGCA
GAATTAAAGCGAAGGATTTATGGTCGCGGTCCTTACAGCGATTCCTGCTGGGGGGAAAAC
AAGAAAAATAAAATTTCCGTCTAAATGCTTGATATTGCTCATTTGTGCCTTCTTTCTTTT
GTTGGTCTCACACAATGTTTATTAGTATTTTCAAAAAATCAATTTTGGCTCTCATATCTG
TTTTCTGTTATCATTATCATCTGCTTTTAGTCCTTTCACTTATTTATTTGAGTATATTTT
CTTTTTTCAAGCTTATTGAGGTAGGTGTTTAGCTCATTAATTATCAGGCTTCCTTTTTTT
TTTTTTTCTTTAAATATCCTCTGCATTTAGGGCTGGCAGCATGTTTTAACCGCCTTACAG
TTCTGAATATTTTGTTAGTCCTAATGAAAACAAAAGGAAGAACCAACAGGTCAGAGGCAA
GTAAGCATTTACTTAGGAGTAGGGTTTGCAACCCAGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved