Otolemur_garnettii Locus Mono:207:SNORD111
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:207:SNORD111
Otolemur_garnettii
Mono:207:SNORD111
scaffold_70440
SNORD111
1001..1078
1632
TTAAAAAGTTATTAAAATGTATGTTAAATCTATTTCTTCAAAATAACATAAAAAGAGTA
AACATTATTCATATTTTTGGTGTGTAATACTAATTTAAAAATGGAAAAGAAGTTTTAAAA
ATTATTATTATTGCTATCTGAAATTATAATAATAATTATTTTATAAGTATATGATATAAC
ATTTTAGATTTGTTGTCAAAAACTATTTATATAATTATCATTAAAAACCTGTGATCTGAG
AAAAAAGAAAATTTAAGTATAATGTATGAAATATTATTTAAGTTTTCTACTGAATAATTG
GGATTTTTTCTGTGTGTGTTTAAGTGCTTCCCCCCCCAAGGGGAGAGGAAGAATTATGTC
TTGAAAATATAATAGGGAATGGACTGTATTTGGATAGGGACTTTAGAAGATAATTATGGT
TAAATTAAGTCATAAGGGAAGATCTCTAATTGTATAGTACTTGTATCCTATAAGAAGAGG
AAAAGACACCAGAGAGCGCTCCCTCTTCTTTCTATGTGCACAGAGAAAAGGTCTGGTGAG
GGCACAAAAAGAAGGTACCTACCTATAAGCCAAGAGGAGAATCTTCACCAGAAATTGAAC
TCTACTGAATCCTAGTCTGGGATTTTCAGCCTTCAGACTTGGGAAAAAATAAATTTTTGC
TGTGTAAGTCATGCATACTGTGGTATTTTGTTGGTAGCCTAAGCAAAGTCATACACAATA
TCATCTCTTTCTTTCCACTATTTTGCTTTAATTTATAGCCATCACCCTCTTGTTTATCTT
TTGTATAATTGGAGGAATAAAACAAATAAACTTTCTCTGTCATTGTTTGCACACTTTTCT
TTTTATCTAATACATGCTTATATTGGCTATTCTCTTTGTAATTTAAAAACTACTATTGCC
TCTTTATAAATTAAGCAGAATATAAATGAATCATGGAAGACAGATCAAAAGTAGTGGAAA
AAATTTCCGGTGTAATTTGCTGTGTAAAAATTACTACAAACAACTGAAATGATGAGTCAC
ATTCATGTCTCTTCTCTGATAAATTCCTGAAGAAAATTCTGTGTAAAAAAATAATAATTA
CCAAAAACGGGACAATTTTAAACAATACCCAATTATTTGCTCTACTGTGGGTCATAAATC
CAGGTGGGATCATAAATTGTCAGCTGGATGTCTCTTATCCAAGGGTTCTGCAAAGAGCCT
CCCTACAAGCTTATCCAGCTTGTTGGCAGAATTCAGGCCCTTACAGTTGTAGGAGTGAAG
TCCTCATTTCTTTATTGCCCAGAAGCCAGGGACCACTCCCAGAGGACATATTAGGTCTTT
GTTCCATTATCTCCTCCTTCAAACAATAAAGAAATCTTTTATAGCAAATTCCTCTCACTC
TTTCAACTTTTCTGAATCTGTCTTCTATTACTACCCAAAGAAAACTCTCTCATTTTAAAA
GGCTTGTTGACAGAAAAGAAGCCCTACTCTGCAAAGTAATTTTAAAGAGATTTATTCTGA
GCCAGATTTGAAGACCATGACCTGGAGTCACACCCAAGAAGCCTTGAGAAGTGGACTCTC
AGTGGTGGGATTACAATTTCATTTTATATGCCTCAGGGAAACAACAATTATAGCTAAAGT
AATAAATCAATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved