Otolemur_garnettii Locus Mono:155:SNORA68
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:155:SNORA68
Otolemur_garnettii
Mono:155:SNORA68
scaffold_16436
SNORA68
1001..1116
2116
CTATCTGAGCTGCGTATGGTAGAAGAAAAACACCTGGGCAGAGTCTAGAGAAGCCACGT
GTGGTGTGGGACTGCCCTCTGCAGATTGCTCCAGGATGGTGCAGGTGGGGAGCTCCTCTC
AGGCTGAGATTAACCCCCCCACACACACTCACTCACTCACATCTATGGAGCACCTACCTA
TAACTGGCACCAGGTACATAAAGCACATTCCTGTCCTCCAGGAGACCACCACTTTGTAGC
AGAGCAGCAAACACAGAAACATATAATTACCGTTCAGTGCGATGACTGCCAGAAGAGATG
GGTGCACCAGGTTCTATGAGACCACTGAGGAGAAGGAAGGTAATGAGTCTGAGCCAAAAG
TGATGGGAAGGAGAGCCATTCAGAGCAGAGGGGACAACACTGTGGAAGTGCAGGCTTGTT
GGGAGCCATAAGAGGTGTGGCACAGCTGGAGCATGCATAGTTCCCAACGAAGACCCAGCC
AGGGCCAGCCACAGTGGCTCATGCCTGTAATCCTAGCACTCTGAGAGGCTGAGGCAGGTG
GATTGCTTGAGTTCAGGAGTTTGAGATCACCCAGAATAAGAGCAAGACCCCATCTCTAAA
AATAGCTGGGTGTTGTGGCAGGCACCTGTAGTCTCAGCTACTTGGGAGGCTGAGACAAGA
GGATCACCCAAGAGTTTGAGGTTGCTGTGAGCTATGACACCATGGCGCTCTACCAAGAGC
GACATAGTGAGACTCTGTTTCAAAATACGAAGAAAGAAAGACACATCCAGAGAGGCAGGT
GGGGCCAGATAGTGAAAACACAAACCCAGCATGGGGATGCAGTGCGTATCTGTAGTCCCA
GCTACTTGGGAGACTAAAGTGGGAGGATCACTGGAAGCCAGGAGTTCAAGGCCATAGTGC
ACTATAATTGTGCCTGTGAACAGCCACTACACTCTAGCCTGGGGAATACAGGACAGCCCT
GCCCCTTAAACAACAGTAACAAAAAAGAGGACATGTAGCACCTAAATCCCAAACCCAAGA
ATTGCTGTTTCTTGTAGCAGTTGTTTAAACAGGGGTGCTAACAGCAAATTCACTTGGGGA
GCTGAGGTCATGCCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved