Otolemur_garnettii Locus Mono:100:SNORD64
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:100:SNORD64
Otolemur_garnettii
Mono:100:SNORD64
scaffold_104704
SNORD64
1001..1067
2067
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTGATATACATTAAATTATTGGGGAG
AATAGCAAGTTGATAACATCTGTATGTGGTAACATTAGGATATTTTCATTTCATTTCATT
AGATAATTTGCTTGTAGAAACGAATTATATTTCTTCACATTTACCACCTAATTTTGTGTT
ACCTGAATAATTGTTGCTATTTCATATTCATTGTTACATAAATCAGATCATTCTTACAGG
CTAGCTACTGTCCCTTGGGTAGTAGAATGTTGTGTGGAGGTGTTAATCTTTTTACATAGT
TGTTTTAGTCATTGGGAAAAACCTTGGGAAAGACCTTGGTTGGATTTATGATGAGCTGTG
TTTAGTGAGCATGATGAAGTAAAGCTCAATGTGATTACTCTGAAGTCCAGCCTAAGTATT
AATCTAAGGACTCATGACACAAATATTCTGTATATAAGTTCTTAGTAAATTTCCCAAGGT
TTTTTCCTAATCAGTACTGTGCAGGCTAAGGAGAATGGCACCATAGGTTATTTCCACTGC
AGTAAGGGAAGTTGGTTCTAGATCCATCAGTACAATTTTCTTTTGCAGAGTTTTTGTGTT
CATAGCATTGGTATATCTCACCTTTGTTTTTCCATTGTGCATTTCAAATGATAACTTCAA
GAGAGTGGTGACTTTTATTAATAAGAAACTAGTATGGTTTTTCCCTCCCATCACCATCCC
AGTCCACCCTTGTATGGAAATTTCATATATCATATTTCCTATCACTGTGAGACAGCTTCT
CCATAAATGAGAAATTGCTACTTTGTTGGTGAGCTAATTGTTTTGGTCTGGTGAGAATTT
ACTTAATTTATGTTTTTGGCTAAATGCTAAAGTTAACATTTGAGAGACTATTCTTTTTTT
TGCAGTTTTCACCTGGGGCCAAGTTTGAACCCACCACCTTGGGTATACGGGGCTGGTGCC
CTATTACTTGAGCCACAGGCGCCACCCCAGGGACTATTCTTAAGTTACCATTTTCTGTAT
CTTGGTGAGAAAGATTTAATAAACATTTTGGACTCCATATGATTCATTTAAGGGAATGAA
ATTGGCATTTTGAATTTTCTGATACTGAGCCCTTGATGAAATAATTTGCTGCATACCATG
TATTTTTTGAATGATGTCTCTAATCTCACATAATTCTATACTTTTATTTTTTTTTATGAG
TCATATAGGTCTTTTGTTATATCTGATTGGCATTCAGTGATTAGATGCTTTTTTTTTTGC
TTTTAGTAGCTTTTATGAGGGGAGGTTTGGCGAGTAAACAGGTAATTTAGAAAATGCATG
TATAAAAAATATACCATTGGCAGTTGAATATAGCAAGATCTTATTTTTAAGTACTCATAA
TTAGTTCAAAGGTCTATATTTGTGTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved