Otolemur_garnettii Locus Mono:360:SNORA7
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:360:SNORA7
Otolemur_garnettii
Mono:360:SNORA7
GeneScaffold_3063
SNORA7
1001..1140
2140
AAGGATTATTTATTGTGAGTAGGGGCTGCTGCACAGAAGTCTGCATTTTTAGCAAGCCT
TGGCACTTCCCTCCCTGGCCCACAGGATTTTGATGAACCGTTTGAGAGTAGGGATCTTGT
CTATTTTCTTCATCATGTGTCTTTAGTACCTGGCATCTGGTAGACATTAAATAACATTTT
TGAATTAAGTATGCCATTGACCACGAACCATATTTTGAAACCATCCCCTGGGAGAAAGCG
TAAGAGATTAAATGAACACTTTGAACTGCTCTGTGTTGCACACGTATTTCCAGGTTACAA
AGATGCATGTGAAGTGTTTTGAAAAGTTTAAACCAATCTCAAAGCATAAAGCTTAGTGTT
TAGGTTTCTTTGATTGATAAAAAACATTTTTAAATTAGTTATTTAGTTTTACAAATCTTT
GAGTTGGAAGGGCATCATGTTTCAACCCTATTCCCTTTAAACAAATACATTTATTGCATT
AGATGTAGATGAATTAACTGGAGCATCGACAGATTTAAAGATTTGTTCAAGGTGGAGGTT
TTCAAAAGTCCTGTCCACACACAGCAGAACTTCCAGAGAAGCTTGTTCAAGAGTATAGAC
ACCAGAGATTCATCCAAGACTTGTTAAATTAGACTCTTTAAAGGAAATTTGCATGTTTAG
AAGTGCCTTATGCATCACTGGCGTCCAGCACAGTGCTTCTCAAACTCCAATGTTTATTGA
ATCCCCTAGGGATCTTAGTAAGTTACGAAGTCTGATGCAGCATGTCTGGAGTGGGGTGCA
AGATTGTCTACTTCCAGTAAGTTCTCAGGTGATGCTGATGCTCCTTGTACATGGACCACA
CTTTGAACAACAAAGATCCATGGCAGTGGTTCTCAAAGTGTGGTCCCAGAACCAGCAGCA
TCAGTAGCACCTGGGAACTTGTCAGAAATGCAACTTCTTGGGCCTCACTCCAGACTTACT
GAATGTGAAACTCTGATGCGCATTTAAAATTTTAGAGTATGGACCTCCTGGGATCGCGTG
TGGAGAGCCCCTAGTGTTCCGCCAGCTTCAGAAGCAGGAGGGAAAGCAAGCCTAGTGGAG
GTATCCATTTCACTCCCAGCTTGCTCTGTAGCTGGTTATTGGAAGACATTCCACAACATG
TTAAAAAAATTAATAAATAAAATTTTAGAGCATGGTGAAAAGATGCCCTATTAAATAAAT
GGTGCTGAGAAAACTGGATAGCCATATGTACAAAAATGAAACAGGACCCCTCTCTCACCA
TATACAAAAATTAATTCAAGATAGATTAAGGACTTAACTATAAGGCATAGTGTCATACAA
ATTCTAGAAGAAAATGTAGAAAAACCTTTTCTAGACATAGGCCTAGGTGAAGATTTTATG
ACTAAGACCCCAAAGGCAAAAACAATAAGCTGAGTTTAGTTGCTCACCCCTGTAATCCTA
GCATTCTGGAGGGCAAAGGTGGGAGGATTGCTTGAGGTTGAGAGTTCAAGACCAGCCTGG
GCAACATGGTAAGATCTCCTTCTCTACAACAAATTGAAGAAAAAAAATCATCCTGGCATG
ATGGTGCATGCCTATAGTCCCAGCTACTCAGTAGCCTGAGACAGGAGGATCCCTTGAGCC
CTGGAATTTAAGGTTGCAGTGAGCTACACAACTGCTCCAGCTAGAGTGCAGAGCAAAACT
CTGTCTCACAAAAGAAAAAGAAAAGAGAGAGATAGAGAATTAAAAAGTTTCTATACAACA
AAGGAAATAAAACAGTAAACAAGCAAACTACAGAATAGGAGAAAATATTCACAAACTATA
CATCCAACAAAGGACTAATAGCCAAAATCTACAAAGAACTCAAATAAATCAGCAAGAAAA
CATCAAACTAACCCTCAAAAAGGGGGCAAAACGTAGGAACCAGAATTCTTTCAAAAGAAG
ATGAACAAATGGCCAAAAGTTATGAAAAAATGTTCGACATCACTAATTGTCAGGGAAATA
CAAATTAAAACCACAGTGAGGTATCTATCACCTTACCTCTGTCAGAACAGCGATTGTTAG
AAAGTCAGAAAAAACAATGGACGTTGGTGCAGAGCCACAGACAAGGAACTGTCGGTGGGA
CTGTAAATTAGTACAACCTCTATAGAAACATGTATGGAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved