Otolemur_garnettii Locus Mono:286:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:286:SNORA11
Otolemur_garnettii
Mono:286:SNORA11
GeneScaffold_2122
SNORA11
1001..1117
2117
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCATACGTCAGACACAATCTTTCAGAGAAGTATTAGACTGCCTGATCATAACATA
ATATCATCTGGGTAATGATATATAAAAATGAAGGGATCTTGCTAATCGTTAGAACACAAT
GTACATTTTTTCAAAGTGTCATTTTAAAAATTACAATATAAGTGGTGTGCTTTAGAACAA
GGGGCTTCTCTGTTTACAGCACACCCAACAGGACTCTGGGTTATTACCGTGAGGGGCACA
AGACTTAGGGCCTCCCTAGGAGCAAATTCCCTACATGTGAAGAACAAGAAAAAAATTATA
TAATGTATGTGGTGGATGTATGTCTGATCAGTGTATGATTCTTTCCAATGTAATGCATAT
TTTAAAAATTGCCTAATAAAATATTGGAAAATTAAAAAAATATATCAATACACTGTACAA
AAAAGTAAACACTGAGTTTCTTGAAACCAGTTCTGGAAACATAGTCACTGGCCGCGTATG
TCTTGAAAGTCAAGAGACCTTGTTTTTTTCCGTAAGACTGGGAAAGAAAGAGCAAAGATG
TCCTGGCCACTGTTAACCAAAGATGCATTCTTGATCAAATAATAAAAACTTAGTAAGACA
AGGTACCCCCAAAACACAGGAGGACTCAAATTGGTATCAAGAGCTATCCTGGATCATTAA
CCCTTTTAGCCGACCAAAAGCTCTTTGAAATTGAGGCTCTTGGCCACTGATTAATGAGAT
GCGGGCAGGACTGTGGGCTTCAAGTGATGCTCTGAAAATTTATTCAATTTATACAGCAGT
GAAGAGGTTAACTTCAGTCATCTCCTAGGGAACCAGCAGGGAGAGTCTACATAAAAATGC
CGGGGACATTACCGATCTGCTGTTTACTAAAGTAAATTTTGATTGCTACTGACAGTTCTT
TTCTTTTTTTATTTAAGCCAATATTTTGTTACTCTCTCCAAGCTAATGCCAGGTAGCTTG
TTACAAATGCAAGAATACTCCCTCCATGCTAGGAAGAATTTATTTAAAAAAAAAATTGCA
AAAATGTTCTTCCAGTGTGTATATTTACAATGAACTAGATTTAAATCTTGCTCACGTGAA
AATAACCACAAGGAAAATCATCTAAAGTGTGTCTGTCTTGTGAAAATAATTTATAAAGCT
GCATCCACTTTCTTCTACACTAACGTGATGAGGTTAAATTTCTGCAAATTACCCATAACT
TGATTTTAAGTTGTCAGATATTTTGTGATATATTTGCCAGTATTGTTTTTTCTTACATCC
AAATCTTGATTTTTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved