Otolemur_garnettii Locus Mono:424:SNORD29
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:424:SNORD29
Otolemur_garnettii
Mono:424:SNORD29
GeneScaffold_4226
SNORD29
1001..1065
2065
TTTTGTGTGTAGAAAACAACAACGACAACAAAAACATATCCCGGCTAGACCCCGGGCAT
TATGTCTTGCATCTCAGATTCCAAGTCAAATATCCTGAAGAAGGAGTTCATTGGCCCAGC
TTGGGTTAGATTCCTCCGTGTAGGTGAATTTACAGTGACTAAGGACCAGAAAACATTAAA
ACATAGCTGCTGCTCCTGCAAACATGTTTGGGTAGGAAAGCAATTCTGGGAAATGGAATA
TTGAGCAGAAAATCCCCCAATGTTTCTTTAACTGCTTTATCCTTAATTATTTGAAGGACA
CAGAAACCCTATAAACAGCCACTGCTTCCTTCAGAAAAGAATTGCTCTAGGTTGCACCTC
CCAATCTTTGCTGCAAACCTTTACTCTCTCTTCTAATAGATCCCTGTAGACTCTGCAATA
CTCAGCTTCATGTCCTGATTCTCTCTGTGCCTATCTCCCCCTGACGCTAACTTGAAAGGT
CCTACCTAACACTTCATTCAACTTCCACAGCATAGCCGCCGCTCTGATAACTCCAACTTC
ATGCTTAACCCCAGCTCCCAGACATGGCACCTTGATTCTTCTCTCTCTGTCTCTCTCTCC
AGATCAATATGAGAGTACAAGCAATTCAGTTACATTGTCTGTGCTTGTTAGGTAAAGTCC
AAGTTGCAGTAGAGCCCTTCACCCAGGAGGTGTGCCAAATGCCCCTACATTATGCCCATT
ATGTGAGAACTTACCATTCCCCTGCCATCCTCCTCTCTCCCTCTACCCTCTTTCCCTACC
CCCACTTAAATTTAATTGTGTTTTTCTCTCCTGTGGGTATGTAGCTGTTCATCTACTACA
TCACAAAGTCCCAAAGCTGCTGATGCTGATTCCTACTCTCTTGGGAGATGATTTACTGAT
CTGCAAGGACATGAAGCCCAAATAGAAAAACACTTTGTCAGAAAGCAGACAAACCCGCCA
AAGAGATAGCAATATATTTTGAAGCAAAGAAGAAAGCAAGATTTCTGTGATGAATCAAAC
TAGCTCATTATGATTAACAAGGAAAATACAGGAACGCCTGGGAAACTGGAGAGAGCAGGA
GTGAGGGGAGAGAGCATGTTAAAGGAAGCATTCACCCACAGCTTTGATTTGTCCCAGGAA
CTGTTACCAGAAACCTGCTTGTTGGCACAAAGGTCTAGCACCTTGTCTGGAGCCCAAGAA
CGATTTTTGAGAGGGAAACTTAGCCCTCTTCAACCCTACTCAGGTCTGAGGAAAGAATGG
TAAACAAGCACTGACCTTTGAGATAAGCAGCAGTGAGACAATTGCAAGTCACCCAACACC
AGACTCCCTGGACCACAGTCATAACTACAGCTTTAAACAGGCAAGAGACTGATTCAGCAT
CAGTTGGTCCTGAGAGACCAACTATGGACTGCTATGCATTCGAGTGTCTTCATGCCCCTG
ATTAACTCTCTGGGACAGAGAACCTAATGGTAAGACATTTCAGCATTCATTTCTACCCCT
GAGTATGGATCATATGTGCTCTCCTTTTTGAAGGAGAAAGAGGAGGAGGAAGAGGAGAAG
AAGATGAAGAAAGCAAGAATGAAATGCTAGAAAAAGCAGAAAAATTATAAACAGGGCACT
CCTAAAAATTAAGTGAGCATTGTAGCATGGAAGAGTCCAGTTAGATTCAGGAAATCTGGA
GTCCAAAAACCGCACATGCAGGGGTCATTTTGTCCTGTTGAGCAAGTTCTGTGCTGCAGG
GAGATGCACACTTGCAAGGCTCAATACTCCAGCGTGGACACAAGCTATTTCTTTTTCGTA
TCATTCAAAAATGAGGTTATCAAATGGACATTATGGATAGGGATAAAATGAGAAGACAGG
AAAGATATTTTCTTTCGCTAAAGGCACAGGACAAATGCTCCATCCAAAAAAAAAAAAGAA
AAAGGTTACAAAAAAAAATGGTTGATGGTTGGAGTGGTAGAGTAGTAGTGATGTCTGATA
TAGCAAAATTGTTGGGGAATATATCAGAAATATCTATTGAGGGGGAAAGCAGTTAACATA
CACTGGTCCAGACACTGTTCTAGTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved