Otolemur_garnettii Locus Mono:228:SNORA30
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:228:SNORA30
Otolemur_garnettii
Mono:228:SNORA30
scaffold_78729
SNORA30
1001..1137
1888
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGCGACTTTTAGGACACCCTGTGCAATATTCTAGCACACAGGTCCAAAAGGCTTTTC
ACCTTTCTCTATAAAGAAAAAATGGATACCCGCGCTATTTCTGAACAAATGTTTTCACTC
GCCAAGTCTGGCAGGGTTGACTTAAACAGAATAGGCTATTTAGTATCAACAGGAAGCTGC
TTCTACTTTATGAATAAATTAATTATAAGTGTTGAAAAACTTTAACCATGCTACACAGAG
CAAAATCGGAAAATGAGGATTTAAATTTCTTTGTTTCAAAAGCAAGCTCAGGAAATGTAA
CATGATTATACAAAAGAAAATTTGGAAATCTGAGAAAAGAAAATACATCCCTCACAGGTC
CTCCCTGAGGCAGTGGGGCTAGGATTTGGTAGCTGGTGCCGAGAAAAGACCCTTTGACTT
CTTTGGCATCTTTGCTCTGGGACTCTACCAGCGGCAACTGTCACTCAATGGGACAGAGAT
GACTCTGTAACTTCTTACCTAACTTTGTGCCTTTCTTTTATCATTCTAACCTTTAAAAAA
ATAAGAAAATATATCCCCTTCCCCAAAGCTCTAAAGCCCACTTAATCTAATTTAACTGGT
TAGTATTTCCTTTTGGTCTTTCCCTCCCAGCACCATTTTTTGACTGTTGAATCACAGCCT
ATAATTTTTAGTTATCAGAAAAGAGCACACTTTCAATGGCTTTATAAAATGGTAAAGTAT
GGATACAATAATCACTTAGCTACATTCCCCATTATTATAAATACAAGCAGCTACTAGTTT
TTCCACTACCACAAATAATTCTGTGATTAACATCTCAGAACAAATACTACTAAATCCTGA
GCACCTACCCCAGTGCCTGACACACAGTAGGGAGTTTGAGAAATGGGCTGAATGACTAAA
CAAATATAGCTTTTTCCATATTTTGAAATAGTCCTTAGTCTCAAGGATTACCAGGTATCA
GCATTATTATGGCTATTACAATTATTTTTCAAAAGGGTTATACTGATTTTCAGGTGCCAC
TAGTAACGTCCTTTTGAAATGTTGATATCTTTTAAAAATGCAAGCATCAGCTCGGCACCT
ATGGCTCAAGCGGCTAAGGCACCAGCCACATACACCTGAGCTGGCGGATTCGAATCCAGC
CCGGGCCCGCCAAACAACAATGACGGCTGCAACTAAAAAAATAGCCAAGGCGCTGTGGCG
GGTGCCTGTAGTTCTCAGCTACTTGGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved