Otolemur_garnettii Locus Mono:76:SNORA30
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:76:SNORA30
Otolemur_garnettii
Mono:76:SNORA30
scaffold_100121
SNORA30
1001..1124
2124
CAGGGTCTTAAAAATAATCTAGTTATATCCTTAAAAATCAACTATGAAATATCTTCATT
TCACCCTTTTAGGAGATGCTTCAAATCTTTTTTCATACAAATTAAGCTCCACATACTTAC
ATATTTCTGTTTAAAACAGTACTATATGCTATGAATTCATGTGGTCTTTTAGTTCAAACT
TCATATAAATCTATTGAAGAAGGAAGTACATTCAGTAATGGTGTTTTAAACAAGTCTGAG
TGCAAGATATCATCAGAGATTCTAAAGGGCATATTGCCAAAAAAGAAAAGATTTGTTATA
TTGGCTTTTACTACCCCCCTTAAATTTTATTTTCACCCCAAATAAAATTTTTGATCTGGC
TATCAATTGTGTATAATATTAGAAATGACTTTAACTTTGATGAAAATTTTCAACAGCAGA
CTTGATGTTTTCCTGGATTAAAATCATATGTAAACGGTTTGAATTTATTTATGTAGGGAT
CCGTGGATGTTTGAACTCCGAATAGACACTCAGAGCCAGAGAAAGTTGTCACTCACTCAG
GCACAGTTGGCAGCCCAAGGAACTTCAGTATCTCCTGAGAACACTAGATATTAAAAACTC
CCACTGCGAGCTTTAGAAAGTTACTCAGCAGCTGTCTTTACTACTCCTGAGCTCAAGCTG
GTTTCTCATCTAAGTAAAATTACATAGGCATTCCTGGGGAATTATATATAATGACTCTGA
AAAGCTAAATGAGTTTAATTTCATCAATGTGGTGACAATTGACAAACCGTGATACTGCTG
ATTTCAGTCCCCCCACCCCAAGTACAGAGCAATGCATTCCGTCTTCATTTCTTTGCCTTA
TTTTGATTCACTGCTTCTTTGGAATATCTTTTAGAAAGGCTGAAAAAGAAAGCATCCTGT
ATTTCAATAGCTGAGATGGCTTTTCGTGTAGACATAATTTTGAAGGCTGATAAAAGGGAA
ATGTATTAAATATTTTATGGTAAATCAAGGAGTTTAGGAAATGGACATTTGAGACTAATT
CATTCAGTGGGGCCAGGATTTGGTAGATGGTGCTGAGAGAAAACCCTTGATTGCATCTTT
GCCTTGGGATTCTACCAGTGGTGATTGTTGCTCAATGAGAGAAAGAGAAAAAAAAAAAAA
AAGAAAGAAATTAATTGTATGAAAGGCTCTGTATGGATGGATGTGTGTATTGGAACCCAG
ATGGGGGTGTTTTTGAGATCAGACTTGTATGAATCGAGGCAAGAAGGAAGCTAGAAACTA
GACACTGTTCTATGGCAACAGAGAACTATTCATTTAACAGTGATTTCATATTTTTATAGT
CTATCCAAAAGTAGCATGGTCTAGAAAGGAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTGTGTTCAGCCAGGAGCCTGGACTTGATCCCACATCTCTAGTGTAAC
ATTAAAGGAAGCAAGGTCCTTGCGATATACTAGCAGGCACTGTATTCTCAACAGGCCTGG
CCTTGGCCCCGTCTTCCCTACAACACAGTGTGGAGCATAAATTATCAGCCATATGCACAT
TTCTACCTTAAATTTGGAAGATATTTATTTGATTTGTTGACTCATATGCACATGTTTGAA
TCAATGAATAAATATATGTATACACGCAATTAGGTGTATAGACACAGAAACGCTTCTCAG
TGACATTGATTTCTATGAAGACTGCAATCTGAGACAGATTTTCGTTATAATTTTGTTAGC
TAGGATAAATTAGTCTGAGTTTGCTAATGTTAAAAAATTTACATACAGTTGCTGTTGCTT
GGTAAGCCAAATTCCCCACCATTCCCTCACAATTTTAGTAGAAATTAGCCAAAATAAAAA
AAAAAAAAAATAGAGGGTCAGGCTCACTGGTTCACATCTGTAATCCTAGCACTTTTTTAT
TAAAAAAAAAAATAGCAAACATGTAAATATAAAAAGCATTAGAAAACCAATGCTGAAGAT
ATAATTTCAAGATAAACATTCCAAGAAGAGAAAGAAAAAATAAAGGGAAGACAAACATTG
ACCATTAATTCCAGAATAGGGCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved