Otolemur_garnettii Locus Mono:135:SNORA38
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:135:SNORA38
Otolemur_garnettii
Mono:135:SNORA38
scaffold_111442
SNORA38
1001..1108
2108
TTCTTGAGTGGCCGTTATTATTTAATAATATGTCACAAAATTAGCAAGGAAGGTGCTCT
TTGATAAAAGTCTCTGATATCGAGAAGGCTAAAGATTAAATTAATAATTCAATCTTCACT
AAGGGCATGAAATTATTTTATAGCCTTTAGAAGGCTAAAGATTAAATAATTTCATGCCCT
TAGAAATGTTATACTCTAAGAACATAACAAATCATCTAGAATCTTTTAAAATAATCTACA
CATGAGTGTAAAAGAGTAGCACAGAAGACTATTTTGCTAATAAGTAGTAATCTAATGCTG
TTATGGAAATTGAATATTGTCCCTTGAACAGGAGGCAGGAGGGGTTAGGACTGCAAACAT
AGTTTGAGTTTGCAGAATTTCTCCCTCCTGGGTGCTTTCACATTTTTAGACTTATCACCT
TCCCTTTGCATAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTG
AGGCAATTTGTCATTCAATAAATATTCTTCCTTTTACAAATTAGTGTAAAAGCAATACTA
ACACCAAATTACTGCAGGGCAAATAAGACGGGAGGAGGTTTTGACCATGTGTGTGCAGAA
TTTCATGTGTGATCACAGCAGAATACACTTTACATGTTTAATATGAAATATGTAATAAAA
ATTTTTCCAGTGGCATTAATAACTTTCATATTTGGTTATCACATGTGATTCTACTAAGTA
CATAAACCATAATTTATGTCACACCCCTCCACGAGGAGACGACTCAAATTGTTTTCATTG
TGCCCTTCCTCGGACTATCCAGCACGTGAATACAACTTTCGCAACTTTTTTGTGAATTCT
TTTCCATACAAATGTTCATATTCATTTTAAATCGTTCATTCATTTGCTCAAGAAATGTTT
ATATCTTGCTCCTGAGTTAAATGCTTTGTGCAGATAAAAACACTTGCTTAGAAAAGAACT
TCTCTAAGAATTGGAGGCAAAGAAAAGTGGATTTGGAGAAGTCTGGGGCCAGCTTCCTCC
CCAGGCTCAAGATCAACCATCCCACATAGAAGCAAACAAAAAAAAAAGAAAGAAAGAAAA
AAGAAAAGGACTTCCCTATTCCCCGCTGTCGTTCTTGAGTGGCCATTATTATGTAATAAT
GTGTCACAATGAAGGTGGTCTCTGATAAAAGTCTCTGACATCAAGAAGGCTAAAGATCAG
TCTCTGTCCACGAGTTTCCCTCTGCTTTAGTCTGCTCAGGCTGCCATAAATAAAAACAAA
AACAAAACCAACCACATTCAGGGTGGCTGAAACACAAGGAATTTATTTTCACAGTTCTGG
AGGCTGGGAAGTCTAGTTAGGATCAAGATTTCAGCAGCTTTGGTTTGGGTGAGGGCTTCG
TTGCTGGCTTATAGGTGGCAACCTTCTCAATCCACTCTCAGGGCCTTTCCTCTGGGTCCC
GGGGACGAGGCTTGCTGGTCTCTCTTACAAACACACTGATAAGACTGAGGCTCTACTCTA
CAGTCTCATTCTTTTCTCTTTTTTAAAAATTTCAGAATATTATGAGAGTACAAACAATTA
GGTTAGGATATTTGCATGTGTTAGGTGATGTCCCTGCTGTCAGGAGGTGTGCCACATACC
CTGTCATTGTTACTATTAGGTGAGAGCACACTGACCCCTGCCCTCCTCTCCTCTCCTGTC
CCCCCAACTTGAATTAAATTGAGTTTTTCTCTTATGTGGGTGAGTATCAGTTCATCTACT
GGCTTCATGTTAGTGTTGAACACATTGTATACTTGATTTTCCAATCTTGTGATACTTAAC
TAAACAGAATGTTCTCCAGCCCTGTTCAGGTTAGTACAAGAGATGTAAACTCTCCTTCTC
TTCATGGCTGAGTAGTATTCCATGATATACGTACACCACAGTTCAGGGGGCGAGGGGCAC
TTGAGTGGAGTCCATATTTTGGTGATTGTGAATTAAGCTGTGATAAACATTCCTTATGAT
AAAATGATTTTTTTTTCCTTCTGGGTAGAAACCAAGTAATAGAATTTCAATATCAAAAAG
AAGATCTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved