Otolemur_garnettii Locus Mono:366:SNORA15
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:366:SNORA15
Otolemur_garnettii
Mono:366:SNORA15
GeneScaffold_901
SNORA15
1001..1113
2113
ATTGGGGTAAATTTAAACTCTAGTGTTGAAAGGGCCATTATCATGGTTGATAAAGTCCA
TAAATGGAGAAAAGTAGGTGACTAAGAAACAAGAATGAAGGGTCAGAAGGTTCCGTGTGG
GTGGGCAGTGGTGACAAGCGTGACAAGTAGAGAGAATGGCCTTTAAAGAAGATGGACTGA
AAAAATAAATATATATAAAGGCAAAATGAAAATAAGGAATTCTGTATGGTGAACTATCAT
CTCCTCTCTGAGGAACGTCAAAGAGCACACACTGGAAGGAGAGTAAGGGCCAGATCCTGG
GAGAGACTCTCCCAGTTCATGTATTTTCTGTCTCAGAATTCCTGTGTTTTACCCATCTCT
ATCGCTTTCCTTCTTGTTTCGAAGCAAGATGTACTATTCTTCCTTTTTAAGCCCGTTTTC
TCCACCTGTGGTGTTAATCTTGTTCTCTCCTGTCTCATTTATCAATTCCGTATCTTTTTT
CTTCCATGTCAATCTTGTGTTCTTTTCTTGTTTTTTCTACTTTCAACAAAAGTACCTGAG
TCTCTCTTACGTGAAAGTCAATTTTTCTTTTGGTACCTCTTTTGAGGTTCTCTGTCAATT
CTTGTTTCACTTTCATAGCTAATCAGGCTCTCTACCTTCTAGCCTTTGTTTGTTCACCAC
TTATCCAATTTAATGGTATTGTCACTGACTCCTGCTCAGCCAGTATCGGTGATCTTTTAA
TCACACAATACATTGTGATTTCTAAGCCCTTAATCCACCAAACCTCTCTGAAGCATGTAA
CGCTACTGATGTTTTGTCAAAATATGATCATTGGAGTTTCTGTCTGGAAATACTTTCTAT
AGTAATAGATTGATCAATTAAACAAATATTTATTGATTGGTTACTATGAACCAGCACCAT
TTTAAGGGGGGAAAAGTGTTTAACAGAAACAGACGAGGTCCCTGGCTCTGGTGGAAGTTA
AATTGGTGGGTAAAACCATTAATTCATCACACAGTGAGGTCACATTGAAAAGGGTGACCC
AGCCAGACACCATGCAAAAGCAGTCTTCCCTTTTAAATGACTGATATGCTAAGTTATTTC
ATAGCATATCATTTTGTTAAAGGTGAACACAAATATGTAAAAAAAAAAAAAAAAAAGAAA
AGAAAAGGGTGACCAAGTAATCTTCTGAGAGGGAGATGTGACATCCTCAGAGTGGTCAGG
CAAGGCTACTCTGTGGAAAGTCATTTAAGTTGAGATCTGAGGGGGCGTGCAGGGCTTACC
TGAGCTAAGGGAAAAATGGAAGAATATTTAAACAGAGGGAGCAACACTGCTCAAATTGTC
TGTGGTAGAAGGAAGTGTGGAGAGTGTGGTTGAGGGGTGAGCACTGGGGAGTGCCAGGAG
GGAGATGTAACAGGCGCTGGATCACCAGGGCTTTATCAACCACGTGAAGGAAGCAACAGA
GAGCTATTTAAGAAAAAATCAGGCCAGGCATGGTGGCACATGTCTGTAGTCCTAGCACTC
TGAGAGGCTGAGGCAGGAGAATTGCCTGTGCTCAGGAGTTCAAGACCAGCCTGAGCAAGA
ATGACACCTCTTCTTTATTAAAAATAGAAAAATCAGCTGGGCATTGTGGTGCACATTGAT
AGTCACAGCTACTGGGGAGGCTGAGGTGGGAGGATCGCTGAAGCCCAGGAGTTGTGATTC
TAGTGAGCTAGGCTAATGCCATGGCACTCTAGCTGGGTGACAGAACAAGACTCTGCCTCA
GAAAAAAAAAAAAAAAAAAGACAATCTTAAGGAGGTGGATGGAAAAATACTGTTTGGTCT
GCAGTGTAATAGACTAGCAGGGAGCAAAGCGGGTGGGACTTCTCAGCCACTTGAGGCTGT
TACACAGTACAAGCAAGAGATGATGGTGTCTTAAACCAAAGACATAGTGGTGAAGGATTA
CGTAAAACAATGATCTAACAGTGATTGGTACATAAAGGCAATGAATAAAAATCACTGGTT
CCATCTATTTATTGGCAAGTATCGTCAGTTGAAAACACTGGCCCATTTGGGGATAGCTTA
CCAACTGCATTCTTTCCCCCTCTTGACATGTCCCTGTCTGATTTGCTTAGCTCATCACGA
TACCCTGTCCTTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved