Otolemur_garnettii Locus Mono:56:SNORA46
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:56:SNORA46
Otolemur_garnettii
Mono:56:SNORA46
scaffold_6899
SNORA46
1001..1132
2132
AACATTGGGATTTTGTTATAGTTGTAGAAATAGATATTCCATGAGCATGAGTGAAGCTA
TTTTTCAACTGAAATTGTAGGATTGATGTATTTTATTTAAATATACAACTGATATTTTTG
CCTTGCAATACCTGCATAATCACTGGCAAGACTAAATCTATTGCAACCAGGAAAACGCAA
CAAGAGCTATCAACAGAGTATCAGATAAGGGACAGTAAATGCACCCTGATCAACCATGGA
GCTCATTCTATTAACCTTACACGTGCACAGGGCCACCGCTATGAGTGACTAGAGGAGTAT
TTGGTTACTTAGATTTTTCAGAAGACAAAATAATTTCCTTTTTTCATCTTGTTTCCCCTA
AAGCAAAATCTTTCTACCATTTCTCTCTTTGCACAAGTTTCCCCAGAGTTGATTTTCTGG
AAAAATTAATTAGATAAAATCAATTTTTCATAAGATACTGAGGTCTATCACAAATAATAT
ACAAAACTTTAGGTATATTAGTTGAAGATTTCCAAACTTCACTTTTGATTATACATAAGA
TTTAAAGACAATAAAGTTCAATTCACATTGTAATCACAGATCATTAAATATCATGGAATT
TTTTAGAAAGAAACTTTTTCTCCATGATAAATTAATATATATAAGGAACTAGGAAATGCT
GACATCAGTCAAGGAAAATATCACATGGAAATGAGAGCATGATAGGCATAAAACCACTCG
ATATGTCTCCTTATTCCCAAATTTACCCCCCAGTTTCATAGTCCAAATTATTAACCTCAG
TTTTCAAAAGGCTTCTTAAAATGATAGGATTTTTTGCTGACTTAATTTATAATATTTAAG
GATCATCTGGGATGGTACATTCTGTGTAATGAAAATTGTGGCATCCACAAAATCCATTTT
GAGATTGGAGAGAAAATAGAGTTATGATATATAAATTCAGCCATCCTTCCTTTCTTACCA
TATTTCACCCTAAGAAATGTTTTTAAGACTCAACAGTAAACAGCACTATATTTAAGCCTA
TGGACAGGAATCTTCCCCATTCTTGGTTACACTGTGAAGCAAAAGAATTCCTGGTTTTCT
CTTGCACAGCTGACTTGTACCATTCTGGTGTTCAATGGAGTTAAGGAGCTTTAGAAAACA
ACAACAAAAAGAATCAATAATAAAGTAGCTCTGTGTAGGTATTTTAGGAATAGGGAAGAA
TCATAAGCTGTGGTCATTACCCTTAAAGAGCTCATAATCTATATAAATAAATCTAGAAAT
AATTCAAATATTCTAAAAATAAAACTTAACATTAAAAAATACTACCCTACATACACAGTA
GTATGACATATGCCTTTTTCTTTTTCTTTTTTAGAGACAAAGTCTCACTATGTTGCTTTG
GGTAGAGTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGAGATGAAAGT
CCTATCTCCAAAGGGCAGCCTTTCAATATCACAATTTAATCCCTGCTTAAAGAAAATATT
GAAAGGTGGAAACATCATGATGGATGTTTAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved