Otolemur_garnettii Locus Mono:187:SNORA21
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:187:SNORA21
Otolemur_garnettii
Mono:187:SNORA21
scaffold_55179
SNORA21
1001..1124
1512
TTTAGCCTTGAGCTCAATCTCACTTGAGATTGCTGTGAGCTAGATGATGGCACAGCATT
CTACCCAAGGCGACAGAGTAAGTCTGTCTCAAAACAAAAACAAAAATTACCATCATTAAA
AGCTGAACTACGAGTGGAAAAACAAACTATTTTTTTTCCTATTATATGCATAACACAGTA
AGTACAACCTCAAACTCTTGGGCTGAAGTGATTCTCTTGCCTCAGCCTCCCAAGTAGCTG
GGACTACAGGTGCCCGCCAGAACGCCTGGATATTTTTTGTTGTAGTTGCCATTGTTGTTT
GGTGGGCCAGGCTGGATTTGAACCTGCCAGCTCCAGTGTATGTGGCTGGCACTCTCGCTG
CTTGAGCTACAGGCACCAAGCTGCCATCCCCCTTTTAAAAAGCACTCAATGGGCCTTTTG
CTAATGACCCATTGAGCTGTCAAGAAAGGGTAGATTAGGCTCAGCTCTTGTGGCTCAAGC
AGCTAAGGCGCCAGTCACATACACCTGAGCTGGTGGGTTCGAACCCAGCCTGGACCCGCC
AAACAACAATGACGGCTGCAACCAAAAAAATAGCTGGCCGTTGTAGCAGGTGCCTGTAGT
CCCAGCTACTTGGGAGGTGGAGACAGGAGGATTGCTTGAGCCCAGGAGTTAAGGTTGCTG
TGAGCCGTGATGCCCACAGCACTCTACCCAGGGCCCAGGGTGACAGCTTGAGGCTCTGTC
TCAAAAAAAAAGAAAGGGCAGATTAAAAGCACTTTTTTTGTTGTTTTTTTTGAGACAAGA
GTCTCAAGTGGTCACCCTGGGTAGAGTACACTGTTGTCATAGCTACAGCAACCTCAGTCT
CTTGGGTTCAAGTGATTCTCTTGCCTCCTTCTCCCAAGTAGCTGGGACTACAGATGCCCA
CCACAACGCCTGGCCAGGGCTGAATTTGAACCCACTAGCTCTAGGTCACATGGCTGGTGC
CCTAGTGGCTGAGCTACAGGCGCCGAGCCTAAAAGCACTGCTTTTGGGTGAAGTGGCAGC
ATTTTGTGTTGTTTTACTTTAATTGGTGGTGTAACAAGATGTTATTAACAATAATTAAAA
AATAAAATAGGCTTGGCACCTGTGGCTCAAGTGGCTAAGGCGCCAGCCACATACACCTAA
GGTGGCGGGTTCGAATCCAGCCTGGCCCGCCAAACAACAATGACAGCTACAACCGAAAAA
TAGCTGGGTGTTGTGGCAGGTGCCTGTAGTCCCAGCTACTTGGAAGGCAGACCAAGGAAA
CTCCTCTGCGCCAATTAGTTGGGACCTTCAAGAAAACCTTTTTATCGTTTTTATTATACA
CGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved