Otolemur_garnettii Locus Mono:298:SNORA70
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:298:SNORA70
Otolemur_garnettii
Mono:298:SNORA70
GeneScaffold_2419
SNORA70
1001..1111
2111
TAGTTGAGGAGGGCAGTGCCCTCTAAATCCCAGAGCAGGTGGAGGAAATCTAATTAGCA
TGTAGTAAGCCAAGGTCTCTTGGGGGAAATCCTGATAAAGAAAGGGTCAGTGCAAAAGGA
GAGGGAACTGAGATGGAGACTTCATTTTCCCAGTGGGAACTTTCTGAAATAAACTAGGAA
TCAGATGAGCTGGGTTCTAATCTTTGCCCTACCAGTGGCTTTTTAACCTTAGGCAAGCAC
CTCTCCTTATCTGAGGTTTCATTTTTCTTGTCTGTGTCCAGTCTTTTGCTTAAACCCCCT
TTTCTTTTCTTTTTTTTTTTTTTTTTTTGAGCTGGAGCCTCAAGCTATCCCCCTGGGTAG
AGTGCCATGGCATCACGCTCACAGCAACCTCCAACTCCTGGGCTCGAGCGAGTCTCCTGC
CTCCACCTCCCAAGTAGCTGGGACCACAGGCGCCCGCCACAACGCCTGGCCATTTTTTGG
TTGCAGCCATCATTGTTGTTTGGCGGGCCCGGGCTGGGGATTCGAACCCGCCACCTTAGG
TGTATGTGGCTGGCGCCTTAGCCGCTTGAGCCACAGGCGCCGAGCCTAAACCCCCTTTTC
TAAACACATGCTTGTTTCATAAAAGCAAAAGGGACCTCAGATCATCAAGTTGCTATCACC
TAGAAGCTTTCCCCAATGTGCACATGTCCAGTCTCACTCTGTATCCGCTAAAGATTCAAT
AGATTTAGTAGCTATGTAGTAAATACGTGTAGTTTGGGGAAATGGTTCCCAGGGAAATTT
GATAAAATCCTTGGTTTATGCATTATGAAGAACGTAACCACATAGAGCAACTCGAGGCTT
AGCACAGTGTTTGCTCCCCATATTGCTCAGTAAGATGTTTGGATGGAGCTTTTCCTGGGC
TAAGTGAAAAGCTAGAGGTGGAATAATAATGATAAGCAATTTACAAAGTGGAGGTTGAAA
GTTTTGCATGAGTGGTGAAGTCAGTGGTAATGAATTGCTATCCGCATTTAAAAAATGAAA
CAGATGTGCAGTGGCTGTAAACAGCAGCTTCCTTGGTAGTGCGCGCAACCCGTTGCTTGT
ATAGGTTTCCCTGAGGGACCTTACAGACAATCCTTTCTGATACATGTTCATGAGTTAGAC
CTTGTGCTGTCCCCAGTCTAGGCTCCAGACTGGTATGTGTGGTGCCTCTGGAAAGCCCTA
AGGCTCTGTGGCCAGGTTTACATTGGCCAAGTCATCATGTCCATCCACACTAAACTACAG
AACAAGGAAGCATGTGATTTGAGGCCCTATGCAGAGCCAAGTTCCAAGTTCTCTTGCCGC
CAGAAGATTCACAAGTCTAAGAAGCGGGGCTTTGCCAAGTTTAATGCAGATGAATTTGAA
GACATGGTGGCTGAAAAGAAGCAGCTCATCCCAGGTGGCTGTGGGGTCAAATACATTCCC
CATCAGGGCCTCCTGGACAAGTGGCAGGCCCTGTACTCATGAAGACTTCCACTGTGCTGC
CCCCACATTCGCATCTACTAGTAAATCCTACTTCCTGTCCAAAAAAATGGAGAAAGAAAT
AGAATGAAATGTAGCATGCATTGTATACAATAAGGGTATTCCTTGAAACTTTTAAGGTCA
TTGTATTTGTAGATAGTGTGCTACAGTTTAAAAAGCATTCCTTGTTGGATTGTAGTCAAA
AGTCATTGATCTGGACAGGGATTAAAGGAGTAAAGATGGGTTGTAGGGGGATGGAGTTTA
AAGAAGCAATGTGGAAAAGACAGTAGGGTATGTAGGTTCTAGTATTTACTGAAACTGGGG
TTCCTTTCCTTTTGGTTTTTTGATGTTGTTTTCTGTTGTTTGAGACAAGGTCTCACTCTT
GCCTGGGTGCACAGTGGTGGGCTCAAACTCTTGGGCTTAAGCAGTCCTCTTGCCTCAGCC
TTCTAACTAGCTGGGACTATAGGTACATGCCACCATGCCTGGCTAATGTTGTTTGTGAGA
TGGGATCTCACTGTGTTACTCAGGCTGGTCTCAAATGATCCTTCCACCTTGGCCTTGCAT
AGAGCTGGGATCATAGAAGTAAGCCACTGTGTCCAACCTACCTAAACTGTTTGATTTTGA
GCAAATCACATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved