Otolemur_garnettii Locus Mono:256:SNORD18
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:256:SNORD18
Otolemur_garnettii
Mono:256:SNORD18
scaffold_83481
SNORD18
1001..1072
1144
ATACAAAACAAAACCACATTAAGACATCACCTAACTCCAGTGAGAAAATTGCATATCAA
TAAATCTCAAAGCACAAAATGATGAGCTTCCACTTCATTGGCCTGTGTTTCTAAAACAAA
TGATATTTATGGTAATTCTGATTTGGAAAAGAAGAAAAAAGAAAAACGTCTCAAAGTGAC
AGATGCAGAGAAGCATGCAGAAAGGAAGAGGGACACTTCCACTGGTGGTGGGACTGAAAA
CCAGTACAGCCTCTATGGAAAGTCGTCTGGAGATACTTCAGAGAACTAAAACTAGACCTA
TTATTTGATCCTGCAGTCCCACTACTAGATATTTACCCAACAGACATGTAATTTTTTTTC
AGACATGTAATTTTAGTTTAATTTAACTTAACTTTAATTCATTTAAAATCTTGAGAACTA
TTTTGGTAGTCTAACAAACAAAATGAGACGATGGTTATATCACTTTTATTTCATATAGAC
TCCCCCAAACCATACACATTAAAGGCCTTAATGTATTATTCTATACATGTTAGGGGAAGA
AACGATTAAATAAATGATACAATGTTCTGGAAGAAAGTTACAGCCCAGCCAGCAATCTTG
GAAGCATTTGCCTTCTTTCTCCAGAGCACACAGAACTGTGAGACTCAGGTATCACCAAAT
ATGAACACAAAGGAGCTGAGCGTCTGGAAGCCTGAAGCCATCAGGAAGGAGATACCCCTC
AGCCAGTGGCCTGGGCTCTGCATCTGGGTCACCTTGTAGGATAAAATGCCAAGTATAGAG
CATGAAAGGAGACAAACACACTGACCAGGATGAGGATGGCGTGTGTGGCTCTAGTTTCAT
GAGCCGTTCTGGGGGAGGGGCTGCTGCTGTGGATGTGCTAGATTTTCTGTATGAGCCTGT
GTTTTAATAGGGATTGCATTAAATTTGTATATTGCTTTGGGTAGTATGGACATTTTTACA
ATGTTGATTCTTCCCAGCCATGACCATGGTTGTCATACTTTAAAGATGTAGGAAACATAA
TATTTCATTTTATATGGAATCAGAAAAAAACCTCGAATAGCCAAGACATTACTCAGAAAT
AAAAGCAAATCAGGAGGAATCATTCTATCAGACTTCAGGCTATATTATAAACCTATAATG
ATCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved