Otolemur_garnettii Locus Mono:491:SNORD70
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:491:SNORD70
Otolemur_garnettii
Mono:491:SNORD70
GeneScaffold_1580
SNORD70
1001..1085
2085
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTT
TTTTCGAGACAGAGCTCAAGCTGTCCCTGAGTAGAATGTCGTGGCATTACAGCTCACAAC
CAGCTTCAACTCTGGGCTCAAGCGAGTCTCCTGCCTCCGCCTCCCAAGTAGCTGGGACCA
CAGGCGCCCGCCACAACACCCGGCTATTTTTTGGTTGCAGCCATCGTTGTTTGGCGGTCC
GGGCTGGGGATTCGAACCCACCACCTTAGGTGTACATGGCTGGTGCCTTAGCCGGTTGAG
CTAAATGCGCCGAGCCAACACTGCTTGATTTTATACATGTAATATTTAAGCGCATCACCA
GGCAACAATAGGGGTATCACCGCTATGTTTAACCTACCAGAAAGGGAAACTCAGGAAACT
TCCAAAAGTAGTAAATACACCTGTTTATTAAAATACAGGCAGGCATGTCAATGGTATATT
CTTGTTGGGACTGAATCTAAGTGGTCTAACACCAGCATTTGTTACTAACACTGAGACAAC
AATGCCAAAAAAATTCTGGATGTACAATTGTTATGAAGACAGAGTCAAGGTATTCTAATG
TGAGTTTTATTTTATATTATTCTGCTGTTATATAGGGCATAACCTCTCTCAAGGCCATTT
TTGGCCTACAGTCAGTGATCACCAACACACAATGGTGGTCCCCCCCTTTCTCAGTAGCCT
TCATGAGGCAAATTGGCTCCCTTCTCACCTACGCACGCATCAGCCCATAAAAGTGCTCAA
GATTTAGACTTGGGCTGCTGTGTTTTAATTCCTTTTCCATTTCTAGTAGATTAGAAAATG
ATATGCACTTTCGTCTGCCAAAAGCAACGCCTGTATTTCTGGCAGCAACCCCATTACAGC
TATTACATAGTAAAGTGGATACCAGAGCTACAAAGGCAGGAGGTTAGCTGTGAGCTTAAC
CAGTGGCAAATAAGGAGGAGATTAGAAAACTCTGCTGTTTTCACAGATGTCCGCGACCTC
CATAACATACATCACACAGGGGCCATTTCAATTTGTGATCTCCAACCTAGACGTGGCAAA
GGCCTTCCCATTCATTCTAATAATTCTGGTTTCCTACTACAAAAGAATATATTAAGATGT
GGAAGAGTTGCCTACTGAAAGGAAACCCCTGAGAAAGAGCAGGAGAGGGGAGTGTAGAAA
TTCAGCAGTTGTGTAGAACACACTGCAATGGCAAGAAACTATATTTCCATATCTTCAAAG
TAATACAAAACACAGTCACTCCCAGAGCTGGTTCAGATTATTTACATGCCAAACGATTTT
TAGTCTTCTGTGTAAGTGTTAGGAAGTTACTGGTGTTTATGTGAAATGAGGCTGTTAATA
GGCTTCTGCAGCCGTGACTGGAAACCAGACAGCCTGAGACAAACACAGATTCAGAAATGG
GGTTTCTCAAGCTGCAGTGGGAACAGACTGTAAACAGTTGATTCCATGCAGATAAATGGA
TTTCTGTTATAGGAAATGCTAAAGGATAAGGATAGAGATGTATTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved