Otolemur_garnettii Locus Mono:241:SNORA4
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:241:SNORA4
Otolemur_garnettii
Mono:241:SNORA4
scaffold_83393
SNORA4
1001..1146
2146
NNNNNNCTGAAAATCCCCAGTGATCTACCAAAAGGAAAAAAAAAACAAAAAAACAACCT
AGAATCAATATGTGAGTTCAATAAGGTTGCAGCTTGCAAGGAAAGCGTACAGACATCAGT
TGTGTTTCTATATAGTAGAACGAACATGTGGACCTATAAATTAATAAAAATACTATTTAT
AATTGGCCAAACAATGAAATACTTACGGGTAAATCTAACAAAATATTACCATGTATTGGT
TTGTATGCTGAAACCACAAAATGCTGATTAAAGAAACCAAGAAAACCTTATATAAATGGA
GAGACATAATATTCATGGATTGATTGGAAAAGTTAACATAGAAAAGAAGATGCAAAGAAA
TTAGGTCATCAGATATGGCTAGTGGGAATGTAAAATGATATATTTTGGAGAACATCTAGG
CAGTTTCTTGACAAACTAAGCATACAGCTAGGAAATGGAACATCAGTTAACCCTTGAACA
TTTCTCCCAGAGAAATGAAGACTTATGTTGGTACAAAACCGCTCTACAAATGTTTAGAGA
AGCTTTGTTTTTATTTATAGCAACCCCAAACTAAAAGCAACACAGATATTCTTCAGTGGA
TGAGGAGTTTAAAAAACATGGTACATCCACACCCTGGGATACTATTAACCAACAACAAAG
AGCAAAGCTGTTGAAATGCACAGCGATCTGGATAACACTCCAGAGAATTATAAAGAATCT
TAATTGAAAATTTGACATACAATATAGATCTATTTGTAAAGCATTCTTAAAATTGAAAAA
AAATATATATAGTAGAGATGGAAAACAGATTAGTGGATGCCAGGGAATAGAGAGTGGTTG
GTCTTCTGTCTTGCCTGTATAAGTATCAGCTCACTGGTTGTGATAGTGTGCTACAGTTTC
AAAATATTACCTTTGGAGGAAACTGAGTAAATGATACAGATGTATTTCTACATCATTTTC
TACAACTCCACGGGACTCTACAGTGGTCTTAAGTAAAAGTTTAGTTAAAAATCACTCATC
ATGGGGGGGAAATGTTTTTGTAATACCATTTATGAATTTGGGCTATTTGGGAAGATAAAG
AAAACACCACCCTCCACAGTGGGCTATTCCACCTAGGGTAGCTCACTACAATTTTGTGGC
CTCCATTACACAGGTGAAAAAAAAATCACTCATTGAGAATAGTTGAACAGTCCTTACATT
CTTCTCATTGTATAAATTATGAAATGGAGGGATGGAGTGGGCATCTTTTCGATGCCTTGA
GAAATTGTCATACTCCTTGCTAAGTTTGAATCAGCTTCCAGAATTGTATTACTTGTGCTT
TGAATGTGGTGAAATATTTCTGAGAGGTTTTATAAAGCTCGCTTTCCTCCCTCCCTCTCG
GTGTCCCTCCCTTCTTTCTTTCCTTCTCTCTCTTTTCCTTTTTCCCCTCTTTTCTTTGTC
TCGCTCTCTCTTTCTTTCTCTCTTTCTTCTGTCTTCTTCCATCATTACTTCCTCTGGAAC
ATCTTCACCTTTTCCATTCCCACCTCTTTCCTCATTCATGCTAGTAATTTCACTGTTAGT
AATTCCTCTGACTGCATATCCAGAAGCCCTTGAGTGGGAGCAGTGTCAACATCACCACAG
TCAGCTATTTCTTCTGTATTTCCACTGATATTCCAGTCAAAATTTACCTCTTCCATGATT
GGTTATCTAAATTTTCATCTTTGATGGCCAATTTTCTCTTTGCATTATTCATTTTTGTAA
AATTGTCCCCTAGTTTGTCCCACTGAGAAGAAGAAAGCAGCACAACTGCACACTTTACTG
TCTGGGCATGACATAAACAACAGACGTGGAAGGACCAGTCACCCTCAGAAGGAAGTGGTG
TGATTGGTCATTCATCACGATGCACATCTGTGACATGCGGACTGTCAAGCCAGCACCTAA
GGGCATACTTATATTATGGAATTGTTCACACTAATATATCAAGATAACTAGATTTGAACT
GTGTGGTTGAAGGACTGGCATCATTTAACTAAACTCTGGTGATTAAAAAACTTGCATATA
GTAGAATCCTTGGTGTTTTCCAGATATATAATCATATCATCTGCAAAGAGTGAAAATTTG
CTCTCTTCTGACCCTATATGGATACATTTGATACCTTTTCTTGCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved