Otolemur_garnettii Locus Mono:90:SNORA51
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:90:SNORA51
Otolemur_garnettii
Mono:90:SNORA51
scaffold_9553
SNORA51
1001..1125
2125
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TGCCACCTCTACACTTTAGCCTAGGCACAGAGTATCATCCTGTCTCAAAATAAAACACAC
ACACACACACACACACACACACACGCGCAGCGTGAGTGCAGTAACATGCAACTACAGGCC
TAGTTGCTGAGGGAGGCTGAGATGGGAGGATTGCTTAAACTCAAGAATTTGAGGTGAGGC
TGGACCACATAGCAAGACCCGCATCTCTGAAAATAAAAATAGACCTCCTGGTGCTTACTA
CAGGCTGTGTTCTTACACTGACTGTATAGAAAGAGGAGGCAGAGTAAACCTGCCCTAGGT
ACACCCCAGCCCAGGCCTGGTCTGTATTGTGAATGGGGGAACATGGAGAAAGAAAAATTT
TTAAAAATGAAAATAAAAATAAATAAAATTAAAACTATTCATATATGATTGGGCAATTAT
AATAGAAAAAATGTTATTTTCTTTCTAGCAAGGTAGCAGAGAAGCCATTAGAGAAGTAAC
ATGCAAGTTATTCTTCTATGAGGAAAGGACTGTGCTCAGGACACAAACCCTTTCAGGGCA
ATCACATATTCTTTCTGGTTCAGTCTTGTCATTTTCAAGAGGTGGGACTTAAAGATTTCA
CTCTTCCAGATTTCTATATTCTGCTACCTGAAATTCAGCCTCTCTACAATGCAAGTAATA
ATACACTAGTAGTGATATCCTCCACCAGCAGCAGTAGTCACGGCAGGAAACATTTAGTGA
GCCCTTGCCTGCATACTAAGCCCTATGTTGCGATCTTTAGATACAATCTCCAATTCTGTT
CCCATATTACTGGAAAGAAAATTAAGCCTCAGAACAAGTTAGATAGCCTTTCTTTTTGTA
CAAGGAAACCATGAAACTGGGTTTGTCCACCCTCCTCCAGGGCCCATGTCTCCACCGCCA
TGCTCTGCTGCCTCCCTCTGGCTGCTTTTCCTCGTTCCAAGGGGTTGCAGTCCCAGCCTC
CAGTACTGTCAGCTCCAGGAGGCCAGAGAGGGTGTTTTACAGTATTGTGCTGGTACTACA
GAAATGGTGTGTGAGCTCTGACTCAAGGACCTGGGGTTAAAAAAAGGGACAAATTTGAGT
GCATGTAAGAATCACCAGAAAGATTATATTAAAATGCAGATTCCTCAGCCCATCACTAAA
GAGTCTGATTTTTAGGTCTGAGTCAGGCCTTGGAATCTTCATTTGAATAAATACCCAATC
ACCTACCATCTCCAGTGATTCTGATGTCAGTACTTTACATTTGAGGAGCACGGCCTGGGC
GTGTGTGTGTGTATGTACATGCCCTCATGCTCTAGTTCAATGGTGATTTTAGTAAAGCTC
CATGGAGGGCAGGTGTGGATGTGCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved