Otolemur_garnettii Locus Mono:438:SNORD74
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:438:SNORD74
Otolemur_garnettii
Mono:438:SNORD74
GeneScaffold_1802
SNORD74
1001..1093
2093
TGAGTTTGAACCCAGCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATGAGGACAGGTCT
GCATTGCCAGGGCTGCCTGAAATGTTTTCTGCAAATGGTCTCTTTTGAAGGTTAAAAACT
TATCAATGAACAAGGCCAGTCAACTGCCAAGAGATGGACTCATGCTGTATAATATGCCCA
GAAGATGAAGAATCCCAAATGCCAGTTTGTCAGTTTTGATCTAATGCCACATGTTGCACA
AGTCACCTTTTAGAATTATCAACTCTTTCCTTCTTTGTAGGAAGACTGTTGGTGAAGTGA
AAGCATTCTCAGAACCCACTTTTTAATCATTTGTGACAAAGAATCATCCCAGGTAGCAGG
TACTGAAAGTCGGCCTGGCTCCGGGTGCCCCCTCACTCAGAAGCACGCTGTGTATGTTTT
TGCCCCCTCTGTACCCCCCAGCCACAGCCAAGGGGTCTTTTGTCTTAGTAAGTGGGAGGA
TCTTAGTATACCATGGCTCAAGAGCCTTCTCTCAGAAGGCTTCTTGTCACCTCTGACGAA
GCCCATGTTGGTAGGGACATCTGAGAGTCCAACTCTCAGAGTTGGATGAATGCCAACTGC
TCTGATGGAAAATAAAAGGCTTCTTGTCATTGTCTGTCCTTTGCTTTCCTGTCTTGTCAC
TATACTGCTGTCTGTTTTTTCCACAAACACCTATACCCCCTTTCCCGCCCTGAGCACACA
CTGTTCCCTTGGCCTGGGATGCTCTTCCCTCTGTTTTTCTTGTAACCTGCCCCTTCTTGT
TTATGAGCGCTTAGCCTCCATGTCACCCAGAGAGGCCTTCCTTGACCATCCTGTCTAGAC
TCTGACCACTGCCCATTTCCTTATCTTCCTAGCACCCACTTATCTCCATCATGGCCCATT
CCTGGCTAGGGCTGTGTTTTTATGTGGGTGTTTGGTGGGCTTTCTACCTCATCAGACTGT
GGGCTCTGTAAAGGGAGGAACTCTTTGTTCTGTCCCTGTGGCTTCCCCAGCATCTGGCCC
AGTGCCTCTTTCTAGAATGAATGATTCCATGAATGAATGGATTGCCTCTCTGTGGGTCAG
GCTCACATGAAGCAGAAGGGCAAGTGTGAGGCATGGGTGAATCCAGCGTCTCATGTATGG
GCTAAGATAGCCTTGTGGCCCACCCTTAGTGGTCCTGATAGAGGAATTGGCTTCTTATGG
CCCTTCATCCACTGGCCTGGGCCCTCTCTGCCCACGCTTGCCTATTCCCCTAGTCCTATT
CCTCCTCCCTAGCTGAAGATGGCACTGGTCTGCCCCTCACCACACAGGTTCTCCTGTCCT
GGGGCTCCACCTCTCTGCTTTCTACCTTATTTATTCGTTAGTTCACTGATTCCAGCATGT
TTTTTCCTCTCTAAACTTATCATAGGCCAAGAATACTGGGATGAACAATACACAGCCTCT
GCCCTCAAGATCTTTTCATTTAAGCCAAAGCCTGAAGGATGAGGCCTTTGGGGAAGGGGA
GGGGAATGCTGTTCTAGGCAGAGCTGCCTGTTGTGTACAGGGACCTGGAGGCCAGGCTGT
GCCCTGTCCCACCTCAAGAGATGAGGTCAATGGGGTAGAGCTTTATAATCATCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved