Otolemur_garnettii Locus Mono:130:SNORA57
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:130:SNORA57
Otolemur_garnettii
Mono:130:SNORA57
scaffold_110429
SNORA57
1001..1149
2149
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGATGCTATTTA
AAAGAATTAAGTGGCAAGTCAGCACCTGTGGCTCAAAAGGATAGGACACTGGCCCCATAT
GCCAGAGGTAGGGGGTTCAAACCCAGCCCCGGCCCAAAAAAAAAAGAATTAAGTAGCATC
CAAAAGTTTTTCTCTTTACCCATGAATCTGACCCCAAAGCAAGGCAGTCTTTAGTAGTTA
TTCCTGTCACTTTAATTGTTTGCATTAAGTAGTATTTCCTTTATAACTTGATAGAGAGGA
TTTGACATTGAGTCTCATTCTGATTTATGGATTTTGTGGCAAAATCTTGGACAAGCTAAA
ATATCAATATGTTTAATGGTTCTATTGAACCTACTTTTTTATTATCCATTCTTAAAAGCA
AGAAGACTTAGACTGCACTTAGAAACCCATTACAAGGGAAAGAACTTGATCAAAGAAAGT
AAAGTATGTTTATACAGATTTTTGTCAACCTCTTAATGAACATTAGAATTCCTTAAGCAG
AGGCAACTTTTCACATAGAAGAGGGTGACCACTTTGAATAAAGAGTCTTAGGGACTCCTA
GTGTTTTTCTTGGGAAATAATTAGTACTTCCATGGGCAGAGGATTCAGGATAGCCATTAA
TATGTTTTCTAAGTTTATTGGTTACGAAAGATCAGTATCAATCTCCTTTTCCTAGTGGGG
ACAGAAAGTGCAGTCCTGCTTTCTATTATGTATGGAGGCAGAGACAAAGGGCTTTGGCTC
CCTAGGCATTATGTCTTCAGTGCCAGCATCTTCTTCTACCCTGATTCTAACTTTAATTGC
CAGGATACCAATTAATAAGAAAAAAGATCCATACCAACTGACCATGCCATCCTAAACATA
GGTTCACATCTTTGAAACCTAATGGAGCCCTGAGACATGGGTTGATGATGCAGTTTCCCT
TTGGGAAGTTAGGTAGAAGTTCAGGTCCATGCTGAATATTTATTCATGTAATTTCTAAAG
ACTATGAACTTTAGAAATGGATATGGAATCAGTCTGGGATTGAATCCCTGCTGTACCCAT
TGGCTATATGAGCCTTGAGAAATATTTACTTTTAATTTAATATACATCTGTGTATAGTAA
TGACAAGCACTGTACTAATTGTTTTAAAAATATGACCTCATTGTGTCCTTGTAAAGATTC
TGTGAAACAGATGCTATTATCATCTCCCTTTTCGTCTTTCTGTGCCTCACCCCTACCCAG
TTTCCCTCCTCATGTTTGTTTCCAAACCACTGGTACCTCCCACAATGGGAACAAAGTATA
TTCTAATTTTTATTTAGGAAACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTTTCGGAATCTTCTTCTGTCTCTGATTTTGACAGTTTCATTATAAAGTCTTTGAAT
GGACTGTTCAGATTGAATATGATTGAGACCTTTGGTTTTCCTATACTTGGAACCATTTGA
TTAAATTCCTGACAGGAACCCCTTTTATTCCTAAATACCTTAATGACTATTTCCCAAGGA
AAAAAGCATTCATAATTATTTATTTTTTAGAGACAGAGTCTCACTTTATTGCCCTTGGTA
GAGTGCTGTGGTGTCACAGCTCGCAGCAACCTCCAACTCCTGCACTTCGGTGATTCTCTT
GCCTCAGCCTTCCAAGTTGGTGGGACTACAGGCACCTGCCACAACGCCCAGCTATTTTTG
TTGCAGTTTGACTGGGGCCAGGTTCAAACCCGACACCCTCAGTATATGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved