Otolemur_garnettii Locus Mono:305:SNORA32
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:305:SNORA32
Otolemur_garnettii
Mono:305:SNORA32
GeneScaffold_1309
SNORA32
1001..1122
2122
TTATTGCCTCAAAATGTGTCAAAATGCAAATATCTAATTTATTTCAAAAATACCATCCC
TAAGAATCTGTATTTTTAAAATCTGAAAGCTTATTTTATGAAATAAATCAGGGCTAAAAA
TGGATTTAACATAATAAAAGAATATAAATGGGACAGATAAGCTCTTATGAGTGCAAAGAA
AATGCAGAAGAAATATACTCTGGAAGAATAGTAACTACTGGTAACAGAAAAAAGACAATT
TACATATTTTTAAATGCTGAAAGTTAATAACATATAAGTGAATTTCTTAGAAAATATAAA
ACTTCGGATTATGAGACACAACACAGTAGGGAATGTAGCATAAATAAAGCAAGCCCAGAG
CTTTGGCGTCAGAAGACAATCTGAGTTTGAATCTTGGTTCTACCACTTACCTATGAAATA
GCCAACCCTCAGTTTCCTACCTGTAAAATCCAAACAGCACCACCTGCCTCACAGGGTTGA
AGTGAAAGTCAGATGATATAAGACATGGCACAGAGCAAGTGCTCAACAAATGGTGAGCAG
CAGCTGCTAACAATCTAATATTCTTTTTAGAGCAAAACTCTCACCCTCCTTTAACAGCAA
AAAAGGGGGCATTTCACTTTGGGAAATATATTAGACAGTATCCTAAACTTACATAACTTT
TTGCTGAAGGAGCAAAAGCAAGAAATTTATCTTCAGAAATTCCAAGTAAAATAAGATATC
GAATTTGTACTGAGAGGAGCAAAAGGTAGAAAAAGATTAACTGTCACATAACCGCCCAGT
ATAAAATCATAATCATCATCTCTTCCACATTTACAATATACACTGCAGCCAAGCATCATC
AAGAATAAAGCCAGAAAGCAACTGGAATAAACAGCAATGTGGTTCTAGTTATTTCCCTTA
CCCACCAAAAGCCCCTTTATCCTTTAATCCACAGAATGGCAGGAAATCAACAAACTGTCA
CAAGGAAACGTAACAAAATTTTATTAAATAAAAATTCCTAATGGTCATTACAAAGGCTTT
TAGAATGCAGTTTCTCAATTGCTGTGGACATGACCATAAAAAAAACTTCCAGTAGATTTT
CTATCTGATACTTTGCTAGCACTCAGCCTATTGGGGGACATTTAATTAAATAAAATAAAA
AGAAAATAAAAATAAAAATTCCCTGAACAAAATAGCAATGTAAAGGTGAAAAAATTTTTA
AATTTTTAAATGTCACTGCACAATATACTTAAAGGCAGGGGTCCTCAAACTTTTTAAACA
GGGGCCAGTTCACTGTCCTCAGACCATTTGGAGGGCCGGACTGGGGCCCCTAAGCAGGAC
AGGCAGCAGCAGCAAAAACACCTGGTGGGCTGATAACTGTCCTTGGCAGGCAGCATGTGG
CCTGCGGGCCATAGTTTGACGACGCCTACTTAAAAGTATGGCGATAACAGGATTCCTAAC
ATTAGGTTATTATTCCAGGACAGAACAACAAATGAATTACAACTTTTGACTGTATCATAT
CCACAAAAAGAGAAAGGGAAAGGAAGAAAGTACGATCTAGACAGAATCTGAAGAGCATTT
TAAAATTAAAAACAGGATGATTAAAAATATGGAACTACTAAAATCAGATCCAAATCTAGC
AAATAGGCACAAAAAAAGAAAGAAAATGAGAAGATAGTATGTTTAAAAGAACAAAAGGAG
AAAAGAAGGGAAGAGAGCAGGCAGAAAAATAAAATAGTAAGTCACTGGACCCAGCAGTCT
GTCAATCAGATAACAATAAAATAAGCTAATTAGGTACTTCAAGTAATTTTCATTCAAATA
TTCTTAAGTTTACATAAAGAATATTTTTAAAAAGTATAATAATACATGTATTTAATTCCT
TAGTATGAAACAGTAAAAATTCCAAGTTTTTTATTAAAAAGCACAGCAATAAGTATCTTT
ATAAGTGTATTGTCTGAATTTCTGGTTAAACTCAAAGTACAAATTCACAGAGAGACATAC
GACCGATCTGAGGCATGTGCACATTTTAAAGGCTTTACTGTGCAGCACTAACCTATTTTC
TACGGACTGTATTAACTACACTCCCACAGCAACTGCTGCAATGTTCTCTCACAAACACTG
GCTATTCCCCACTTAAAAGATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved