Otolemur_garnettii Locus Mono:401:SNORD74
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:401:SNORD74
Otolemur_garnettii
Mono:401:SNORD74
GeneScaffold_4248
SNORD74
1001..1076
2076
TTTCTGTCTCTTGTAAAAACATGTAACTTAATGAGTAACAATGATGATGAAGATAAGTA
TTTCCTGAAACATGCGGGACCCAGAGCAGTATGCTGTTTCCCGGCTTCCACTCCCTGCCT
CCCCGTGCAGTGCATTATGATGCTCAAGTGCCTTGGTCGCCTTTAAAAATTATCCTGCAG
TACAGAAAAATTATCCTACAAGGAGATACCACCATACATCCTTTGGGCTAAAATCTAGAA
CACTGATAACACCAAATGCTGGTGAGAATATGGTGCAAAAGTCACTCTCATTCATCACTG
GTACGAATGCAAAATGGGTTGGCGGGGTCTTACAAAGCTAAGCATATGACTCAGCAATAG
TGCTCTTGGTATTTACCCAAATGAACTACACAGAATGTTCATAGAAGCTTTATTTGTGAT
TGTCAAAATCTGGAAGCAACGAAGTTGTTCTTCCATAGATAAATGGTCACACAAACTGTG
TGGTGCCTCCAGATGATGGACTATTATTCAGCAATGAAAAGAAATGAGCTACCAAGCCAC
AAGAGGACACAGAGGAACCTTAAATGTATAAAGCTAAAGAAAGAAGTCAGTCTGAAAAGG
TGAGTCTACCTATGTGGCATTCCAGAACAGGCAAAACTATGGAGACAATAAAGAGATCAA
GGTTTTCCAGGGGCTAGTGGGGAGGAGGGGAAGGATGCATAGGCAGAGCATGGCAAGAAA
CTATTTTGTATGACACAATGATTGTGGACACCTGACCTGTGCATCTGTCAAAACTTATAG
AAGTGCACAACACCAAGAGTGAAGCCTAGTGTGAACTATAAACTTTAGTTCATAATGTAT
TTACAATAGTTCATCAAGTCCAACAAAAGTACCACATTGATGCAAGATGTCAATAACAGG
GGAGAGTGGGGCAGGGCAGAGGAGAGGGGACAGAGGGAACTCTCTGTACTTTCTGCACAA
TTTTTCTGCATACCTAAAACCACTCTAAAACCTAAAGCCCATTAGCCTCTGATGGAGCCT
ATGTTAGTAGGGGCATTTGAGAGTGTTGATGAATGCCCACCCCTCTGATGAAAAAAATAA
AGTCTATTAATCATCCTGAATATCCAATTCCTACTCTGGCATATGCCAGGCTGTCAGCCT
GAATACAGTGCCTGGGTGTGTGTGCACACATACACCCACACAGACACACACAATGTCAAT
ATCAGGGTGTGACCACACTTTGAGAACCACTGGTAGACTCGTTAAAGGTAAGGTCCCTCT
ATCTCTTAGGGAGCCTTTTCTTCTCTCCATCTCTAGGACTGTGATCTAAACACAGTGGAG
GCCCAAAGCATGTTTGCTAAATGACAGAATCAATTAATTAGTCAATGTAATTGGCTGAAA
AGGCTGCAGAATTAATCCATTCCTTGGACTCTAATTACATGCAAATATCTAGAGACAGCA
AAATACGAGTTTGGAGGTGAGGAAAAGAGTAGAAAATAGGAGTTAGCTTCCCTCTAATAC
TTTATAACTTACAGTTCGACACTTTATAGTCATCTGCCAGTTAGTTATCAGGCACACTGT
TGGGGGGGAGAACAAAGAAAGAATGAACTAAAATTCCCCACCTAGAATGATGAGCTCTAT
TTCAAAAATTACTTTGCATGATGTATGTCGAACATAGCACATCCAAATCAAAGTTGTGGC
AAACAAACTCATCTAGTTGTTCTTATCAAGCAATGTTAAAAACAATAAACAATTGTTTTC
TGTAATTGCTTTCCTACAGATCTGATATGATATCATGAGAGATTGTTCCTTGAAAATTCG
ACCCCAAAGTACAGTATTTCTTTACAGATCACAGGAATGTGTAAACTTCTGTTGGAAGGA
GGAATGATGAATGTTATAGAGATGAGGTAAGACCAATTCTTATACATGTAAGGTTCCCCA
TTAATTTTTTGTTATTGTTGAGGATTCATTGAGGGTATAAGAAACCAGGTTACACTGATT
CTATTTTGTTAGGTACAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved