Otolemur_garnettii Locus Mono:208:SNORD24
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:208:SNORD24
Otolemur_garnettii
Mono:208:SNORD24
scaffold_71149
SNORD24
1001..1078
2078
ATTTATAAAGAGAGTCTGCTCACATACAAACTTGAGGTTAAAAGTTTTGTTTCCTTCTT
AGTCCAGTAAAATCCAAGTCAGGATAATAACAAGAATTTGTCCTAAGTTGGCCTAAGAAC
TTCTGGTTTCCTGAGAGAAGCCAACAGAGAGAAATAAATTCTCTAGAGAATAAGTAAACT
TCAATTCTGGACCCATAAGGTTCCTACAGAAAAAGCCCCGAACATGATTTCACAGCCTCG
AATCGCTGAACACAGGGGGACTCCAGGCATCGTGAGCAATGGTAAACACAGATAATGAAC
AGCATGATTTAGCAACCTAAACTTCCAAGACTGGAATGACTGATGTTAGGAGAAAAACCT
TGAAGAAATCAAATTTGACAGTTTAAATGAGCAAAGAACAATTTGCAAGTCAGGTAGTCC
CCAGAACAAGAATAGGTTCAGAGCAACACCATGTTATACAACATGGTTGGATAACATTTA
TGGACAGTGAGGTACAGAAATAAAAAGTGAGGTACAGAACCCAGAAATGAAGTACAGAAA
CAGCTAGATTGGTTACAGCTGGCCTTCGCCTCTGTGACTCTGGTTTGAACAGTAGGCTGC
TTGTGGTTGACTGAAGTTTGGCTGCTGTGATTGGCTGAGGCTTGACTACTTGCTATAAGA
GTAGTTATAGTCTATTTACATGTCATGTGGGATTATAGTTCATTGAATGGGAAGAACTTG
TAGGTGGAACATAAGACACGTAAGCAGGCAGCTTTGGGCCAAACTTAATTTAAGAATGGA
TAAAGAAATACAACACTCTAATTTTTTTTAAAATATAAAAGTTAGAATTGAAAACAGGAG
ACAGAAGCAAGAAAAAAATATTTTAAAAGCAAGATAGATTTAAGCAACAACCAAATAGAA
ATTCACAATGAAAAACAGCATAGCTAACATTAAAAGCTGAATGGACTGGGCAGATGAAGC
ACAACTGAATTCAGAATTAGTTAATTAGAATTAATAGAGAATCCAGATGATGTAAAAGAC
TATTTGTTATCTGAAAGATGGAGATAAAAATAAAAATAGAATTAAATAGAAAATTTGAAA
TAAAAACAGAATTAATAGAAAGTCAGTAAAAATATACATACATAGAAAGAAATCATCCAG
AATGAAGCATAGAAAGAAAAACAGATGGGAGATCTGAAATAGGGATAAAGAGAGATGTAG
GATAGATAGAAGACAGAAGAACTCTCACATGTCTATTTAGGGATCCCAGGGAGATAATAA
GGAGAATAGGAAAGAGCAATATGATTTTTTTTCTGTAACTGATAGAACACATAAATTCAC
AGATTCAGAAAGTACAATGAATCCCAAATGGGTTTCCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved