Otolemur_garnettii Locus Mono:372:SNORA63
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:372:SNORA63
Otolemur_garnettii
Mono:372:SNORA63
GeneScaffold_1171
SNORA63
1001..1123
2123
TCACATGGACTTTCACTTTTGTGTTTTGAAATCCCCACTAAAATTACAAAAGAGATTCA
TGAAAGCCTTTTCCAATTCACTCTGACAACTGTTTCAAAGGTATTAATAAGTCTACCTAC
TTGTTCCATTTTCCTCTTTACGCCTCTTGTTCAAGTCCGGTGGTACTTCACGGTCATTGT
TTGAGTGATCCTAAAACCAAGAATTGTGAACTACATTGATCAAAGGCTTATGTTTCTTCA
TTACTTTTATACAAGAAGGGCACAGCTAACTAGCACTGGAGAGTGTCGCATACTTGGTAA
AATGGCATGAAAAATAAGCAGAGCTGGGAGGGATTACTAGGCTGAAGATACTTATTACTG
TAGAAGAAGCAACCAACTTCTTGCGTGAAGACACCAGTTAAAACCCCAAAATACTGACTA
GCTATGGAACAATTTAAAAATTTTTTAAAATGCATTTACACCACTACCCTACTTGATCGA
GAGCTTCAAACTAGTTTAAAATACAACCCTTTTCCGCTCTTCCTGTCCTTTCATCTTTTT
CTCTCTTCTCTGGATCTCTCCCTTGACTTGTCCAAGTCTTTCTTGTCCATTTCTCTCTCC
TTACTCTTGGACAGTGGTGGAGGAGTATGGTTAATGTAGAGCTGTTAAATTAAGGCAATA
TTACTAAAGATTATTAGTTTACCAGTATCAACATCACTTGTTTATTAAATGAAAGACAAT
TAACAGTTAGACCCAAAGTCAAAACTGGTCAGGTGTCTGGATTATGAAAGGTAAAATAAA
AAGGCACAGCACAAATTATACAAGGCTTTTTAATCCTGCCTTATAAAAATTACCATTTAA
ATTCCATCAATTCATTACTACCTCAATTGAAACTCATTAGTAAATTCATAAGCTACAGTG
TTCCTTAGAGTTCTCTTATAAAGACTTATAATCATCATTACAAGAGTACATATATGAAAA
ATAGTGATTGAACTTCTCTACTGTAAAAAAAGAAAACCAAAATGCAGGTATTGTTACAAT
ATAACTGAAGTGTTTTATTATCATTCTTTCTGCTTAAAGCATTTGATGTATAACTATTTC
TAACTCCATTCCATAGTAAGACAGAGATGCTTAGTCTTAAACATTTTTCCTTGAGTAACA
AAAGTAAAACACAGGGAAAAAAGCCTCTTTGTAATTATGGAAATTTTAAAGACTCTTACC
ATCCACTGATAAGCAGTTAATGAGGACAATGAGCAAAAGTATCAAAATAAAACCATTACT
TTATTCATAAGTCTTTCTGCCTCAATGCAAACCACACAGGTTACCCTAAATTAATTTTAT
AAAAATAAAGGCAGAATACTGTCTATTCTGAAGGTACTCTAATTTCTATCAAATAACCAC
AACTGACTGTAAAATTTATCTTGTAAGTTCTAAATAACTCAGAAATTAAGTCAGCTGAGG
ATGATTAAACAACTCCAAAGACTGAAGAACGATGAACCAATATCTCCTCTGTCTATTCTT
TCTCTGCCAAAAGGCCCAAAGGCAATAAAATGGCCAAACGTCAAAGCTATTCCAACTCTA
CATAAGTGATAAATAACCCTACTTTAGGCAAGTTGTAAATATCAAAATACATCATAAAAG
AAAATATTAAGAAGTACTAAGAAAATAATCAGATACTTAAACCAATGGTATTTATAACTG
TACTACAAGCTAATGTTTAAGACATTAAAAGTATTAGGCGTCAAAACACTGAACAAAACT
CATTACTTAATACATAATTTTAAATATATACATTAGGAATAGGCAGAATAGTGAGTCAAA
AGTCAAATACTTTTACATAAAGAAATCCTTTGGTAGTCAAAGGAATACATAAAAAAAGAC
CATTAGAGTTTGAGAGATAAACACTTATTTTTTAACACCACCAAACATTAGTTCAGAAAT
ATTGCCACTAGCAATGCAGAAGCAGACTCTTTAAAATCTCAATGTTTAAAAAAGTTGATG
ATAAACTAAAACATATAAAATGTTAATTAATAACAATGAGCAAGAAAATGATAAACAGTC
ATAAAAATACTTGTCTAGAAGATACTCTCTTGCTGGGAATAATGCCTTAAATGAGACTTC
AAGATTTTTCTAATTGTGGTTTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved