Otolemur_garnettii Locus Mono:119:SNORA51
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:119:SNORA51
Otolemur_garnettii
Mono:119:SNORA51
scaffold_108158
SNORA51
1001..1132
2132
GTATATGTGGCTGGCACCCTACCCACTGAGCTACAGGCACTGCCCTCAATCATTTAGTT
TAAATAAATTAAAAGTTGACTTTCATTTCTAAGGTTCTAAAAGCAAGAAGATGTTCTAGT
TTGAAATATCATCTTTGAAATGCTGACCAAGTTTAAATATCAAATATGGTCGGAGAAGGA
GACACCAAGTTTTAAAGGATTAGTCTGAAAACATATGTTTGTAATTGAGACACAGATTTC
AAGGAAATAATCAATCCATGCAGAAGAAAGAACAAGATTAAGAAACGACCAAAGTCATTA
TGTTCTCTGTTTTCTTAGAAATGACCAAGATCATTATCCTTTGCTCTTTTAGCAAAGAAG
TTAGGTCATTTTGGGGGCAAGTCAAAAGAAAAAAATAAGTTCCAACTGTCATAAGGTGAC
TATGTATTTGCAATGTACTCAACAGTAAGGACCAGTCCTCAGCGGTGGGAACCTCCCAGG
GAATGATGAGACTTTGGACCTAAGCCATGCTCCCCTGCCAAGGGCTGTCAGCCACCAACA
CCGTGGCAGCTAGAGGCATGAGCGAGTCCTCGAGGGGGGGGTCCCAGTGGCACAGCACAG
CATCCACAGAGTATCAACTTCAGGAGAGCATGGGTCTTTCCTTTCTTGTTTGTAACTGAA
TTCCTCACACCCAGAACAGATCCTGGTCCATGGCACTTAGTGATGAATAAAAATATGGCC
TCTTGGCTCGGCGCCTGTGGCTCAAGCGGCTAAGGCGCCAGCCACATACACCTAAGGTGG
CGGGTTCAAAACCCCAGCCTGGGCCGCCAAACAACAATGATGGCTGCAACTAAGAAATGG
CCAGGCGTTGTGGTGGGCGCCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGACTC
GCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAACTATGATGCCATGGCACTCTACCCAGGG
GGATAGCTTGAGGCTCCGTCTCAAAAAAAAAAAAAAAATATGGCCTCTTGGAGCTTCCTA
CAGGCTGTGTTCTTACACCAAGAGTATATGCAGAGGAGGGAAAGAAACCTACCCCATGCA
CACCTCATCCCAGGCCCTGTGCCTGGTTTGTATCATAAAGGGAGGGGACATGGAGAAGAG
AGGAAAGAGGAAAGAAAGGAAAGAGAGAGAGAAAGAGAGAGAGAGAGAAACTATTTGATC
ACTTAATACTGAGGAAAGCAGGTATCACTTTACATGAGCTAGTGCATTGATTCCATTGAT
TCCTGAGCCAGTTTCCATGTGGGGCTCTCTGTTGGGTTTTCTGCATGAAATTTTTCTCTA
CTAAATTGCATAGATTTATGATTTCTTTATGAGCATTATGACTTTTGCAAATGTACGTAG
AAGTCCACTTTAAATGACATAAAGCATCGTCACTGCATTCCACTTCCGTTAAATGACAGC
TGGACGGGCGGCAGACAGCATCCTCAGTACTGAGGTACCTCTCCCAGGTGTGCCCCACAG
CTCCCCAAAGCGAAGGGCCTCTTGCACCTAGACAGCCTTTAAGCTGTCAGCCGGGTGAGG
GACACACACTGAGATGGCTGGGGTCCTCTGTGGAAAAGGAGGGAGCATTTTGGACAGCTC
TTTGGAAAGCTGTAAAATAAAATACAGTTCAGAACATGGTGTTTGATCAAACAGAGTCTC
AAGTGCCAAGACTCAGCAGAGGCACTCAAAACTGCATGTTGTAGGCCAGAGTTTGCTTTC
ATATGCTCTGTGTGTTGTTTCATTCTACTTGGGAAAAGAACAAAGTTGCCAAGATAGTAG
TGTGGGGGTGTGTGTGCATGTTTGTGCTGTGTGCGTGCACGTGTGTGTGTGGGTGTGTAT
GATGCAGGCACACAGTACATTCCACAGCATATTTACTTCTTGGTTAGAACATTAGTCAAT
ACTTTCTCTTTCATTTAAAAAACTTTTTTCTTGGTTCAAGTACATTTTTTCCATAGAATA
ATTGTCCTTTGCGATTGCAAACCAAGATCAAGGTCACCAACCATGATTTTTTAACTTGAA
AGATTATAATTTTTCTTTCTTTTTTCTTTTTTTTCCCTTTCTTCCTATTTTTTTGTGTAT
ATGTTTGAATAGGCTTTTTTTTTTTATTGTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved