Otolemur_garnettii Locus Mono:396:SNORA9
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:396:SNORA9
Otolemur_garnettii
Mono:396:SNORA9
GeneScaffold_352
SNORA9
1001..1140
2140
ACAGTGGATCCAGTTAAGGCCAGAAATTACTAGGGCCACACTCCCTGCTGTAAGAAACA
GGGAGCTCCAAGGTTCCACACTACCAAGGCATCTTGATTCCAGGTTCTTATGGGTCTGTG
AAGTTAACATGAGTTGCAAACAGTGGCACCCTCTTCCTCTGTCCCTTTCCACCCCTTATC
TTCTCCTCAGCCTTCTCGTAGCAAACAAAGCTCCTGACTCCTCATATCCAATGCCTTCTT
CTTTTTTCTTCTTATTTTTTTTGGAAATGGGATCTTGCTATGTTGCCCAGGCTTGTCTTT
TTTTTCTCACTCTGTTGCCCTGAATACAGTGCAGTGGCAGCATCTTAGCTCACTGCAACT
TCAAATTCCTGGGTTCATGCAATTCTCCTGCCTCAGGCTTCCAAGTAGCTGGGACTACAG
GTGCCACCACAATGCCCTGCTAATTTTGGGGGTTTTAGTAGAGACAGGTTCTCACTCTTG
CTCAGACTAGTCTGGACCACCTCAGCTCAGACATTCCTCTGGTCTTGGCCTCCCACAGTG
TTAGGTTTATAGCAGTGAGCCACCACACCCACCTGGACCCTAGGCTAGTCATGACTACAA
CTTCTGGACTCAAGAGATCCTCCTAAGCTCGGCGCCTGTGGCTCAAGTGGCTAAGGTGCC
AGCCACATACACCTAAGGTGGCAGGTTCGAATCCAGCCCGGGCCCGCCAAACAACAATTA
CAGCTGCAACCAAAAAATAGCCAGGCGTTGTGGTAGGCGCCTGTGGTCCCAGCTACTTGG
GAGGCTGAGACAGGAGACTCGCTTGAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGATG
CCACGGCACTCTACCCAGGGGAACAGCTTGAGGCTCTGTCTCAAAAAAAAATGAGTAAAA
AAAATGACGGTTTTAGAAACCTTAAATAGATCACTAAACAACATTTCAAAGAACCCATAA
ATAAGTTAAAGAAAATGATTACTTTTTACTCCAAAGTAAAGAATTTGAAAGGAACAATAT
TTGGGTCTGTGGTGAGCCTGTGCCCTGTGCATTCCTCGAGTTCCAGCCAGAACAGCTGTG
ACACTGTTTGAGGCCTTGTCTTGCCCTATCCAGAGCAAGATTATAGAAATTTTAGACAGT
TACTTGCCTCCTTTGGGATCTGGTATGCTGGGCGTTGTATAGATCTGTATTGTGTGATGT
GGCAGCATTTGGCATAAATTCCACAAGAAATTCAGTTTTTCGTTCATACCAGCCATATTT
CTGGTGCTCAGTAGCCACATGCAGTGGCTCAACAGCCACATATTGGATTGTGCAAACTAA
AGAACATTTCTCTCTGCAGAAGTTGTTTTGGACAGTGCTGATGGAAAAGGTGAAGGGTGT
CCCTGAGTGTTTGCTATGCTCCAGGCTCAGTACGAATTTTACTTTTTATTATAGTCTTAA
AGCAAAGGCCTTATAAAAGTTGAAAATGAAGCTCAGAGGGGTGGTAAAGGTAGGAGTTGA
ACCAGAGCAGAAAGGAATAATAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGCTGACATGGTAGATAATGGATATTTATTCTATAAACATTTCTCATGC
CTAGAGAGGACTTAGACTCAGGCTTGCCAGGGATGCCTCCCAGGACAGGTAGGGGAGACA
GAGCTGAACACTTTCCCTCCAGGGTCGCCTAGTCAGTGTCAGGACAGGAGACTCCTAAGG
CTGAAGGGACCCAGAGAGGGGAACAGGGTGCTTGCCTTGTGAGTCAGAGAAGGCTTCCTG
GAGGAAGGGATCTTTACCCATTGGTCTGTAGATCCTTCAGCCAGGCACACTCCACAGGTC
AGGGTAAAGTCAAATTTGTGGATTGCCTGAGAAGCCACAAGACCACACACCCATCCCTTG
GTGTATGCGATCTGCCAGGAAGGAGGTGTTTTTGCTCGGAGCAGCAGCGGGTGGGGCGCC
CCCCTGCTGAGAGTATTCTGAAATGATGGGGGACTCTTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved