Otolemur_garnettii Locus Mono:41:SNORA19
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:41:SNORA19
Otolemur_garnettii
Mono:41:SNORA19
scaffold_94104
SNORA19
1001..1122
2122
TTTACTGATATAGTCCCCACGCTTGCTGGGAGGGGTGAAGACAGACGCTTGGGAGCTGT
GGGGGAAGCAGGGGAGGGCATTACTGGGATCTAATTATATGGCACTGAGGATCCATCCCC
AATGGGGGTGAAAAGAAAGAATTTCTGTCCCTGAAGGTATAACCCAAACAGAGTGAGGAG
GTGCCCCAGACCAGGTGAAGTATCCGCCGGCACACCCTTCAACTAAATTGTTGAAGGCAG
GGCCCAGATCAAGTCCTTCACGAACAATGGCTTATTGATACAGAAAAGTGCTGTCTGCCC
TCACACTCTCCAAGTTCTTGGGGAAAAGAGATGAAGTTCAAGAAAACATAATTATCCTGG
CTCCAAACTGAAGCAATAGTAAGGAGGAAGGCAAGGAAAGGTGACAAGAATGTCCAGGGG
AATTCAAAAGAACAAAGATCTAATAGACTCTATAGACTCTGAAAACAAATATGGTAACTG
GTTACAAAGTATCTGTATCTTTATCAGGATAACTAGTGATACGCTGGTAAGTGTTTTTAA
TAATTAGTTCTCAGGATAGGGGCTTAGGGGAAAGCAATTTATAGCATTTACTAATTTCCA
TGGTGTAAATTACTCCCACCATGGGGGATTCCAACCTATGAGAAAGTAGCATCCCTGAAT
GTGAAGTTAGGAGGAGATGCAAACATTTGACTTTAATTGACTAGCTCCAGTGCACCACTG
ATGGTAACTTACAAAATTTCCACTGCAATTACTGTGGGAGAATGGAAGAGAATGCATAGG
ACAGATCATGCTCACATTCTATAAGGCAATATAAGCCAGGAAATTGCCCACAATGAGTGG
TTGTCTTTGTATAACTCAAACAGAACAAATATTTTTAAAAATGAAGACATCAAGAGTGAA
ATATTAAGACAATGAAATCAATTTCAAGGCCAAGGAAATAAATCATTTCTCAAGGATCAA
AATAAAATAATTACAAAATAACAAAATAAATGAGAAATATCAGGAACAAAATTGACACCA
TTGAAAATTGTAATCCTTATTTCTTATGTGCTATACAAATAGTTGAAGGTTAATTACCAG
TATAACTATAAATAGTAATGTTGCCAGTCTCCTTCAGACAAAAAATTTTATAGAAGCGAT
TAAATATATTATTTAAGTAACAGGTCTCTATCTACAAAAGATGTAACCATTTAGGATTTT
TGTTTTGTGAAACCAGGATTTGGAAAGAGGGATAGTATAATCCATGTATGATGTTTCAGA
CCAGACTTTGAAGCTGAAGCCTGGAATTAGAATTCCAGCTTCAGCAATTCTCTGCTGACA
CAGATTCTTTGAGCTTCAGTTTCTTATTTTTTTTCTTGTAATAAAACGGGCATGAATTCT
GCTTGCCATGACTGTCATGACATTGCTAAGTAAAAAGTGCTAAGTAAATAGTGGCAATTA
TTAACCCTGTCTTTCTATGAAAAAGTTTAACAAAAAGAAAACTCATGATCATGAAAAATG
GCTTTACATCAATGAAAGAATGCAATAAAAACAATTTTAGAAATTAATAATTATCTAATA
TGAAGATAACTGATACATTAGAAATAGAAAACCCACCCAACAAATAGTAAAGAAAATATA
CTCTATGGATCAATCCTATTTACAAAATATGAATCCAAATAAAATTCAGCCGCACTTTGG
AAAGAAAAATGCAACATTATCTAATAGGTTTTTTCTGAGGAAGGCAAAGATGATCCATTA
TTAGCTAGTCATATAATTCATTATACAAGTAATTTAAAAAGTAAAAGCTATTCATCTAAA
ATATATCAAAATATAATTTAGTAAAATTCAACAACTATTGCTGATTTTTCTACAAAAAAC
ACTGATATAGAATTTAATAGATACTTCCATGACATTGTGTGTGTGTATGTGTGTATATAT
TTGAATGAAATAAAAAAACTGTCACCACATTAGTGATGAAAAACTCTGAAAACACCAGAC
CATATAATTAAGAAGCACATATAAATAAGGTACAATAATTGGAATTTAGATGCCAAAAAT
TATCATTATTTGCATAATATATTTTAGAATACCTAGAAAACCCAAGAGAATAAACTGAAA
GATTGTTAGAAAAAAATGATAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved