Otolemur_garnettii Locus Mono:427:SNORA41
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:427:SNORA41
Otolemur_garnettii
Mono:427:SNORA41
GeneScaffold_4118
SNORA41
1001..1123
2123
TTATAAAGAGAGCTTTATTGTGTAATAACACCCAGCAAAGGTTGGGAGTCTCTGGGGAT
CAAGCGTAGACAGATGTTATTTTGATGGGCCTGTAAGCAATGCTGTTATTACCACCCTGA
GAGGGGACACAGCTTTGCTCTCGGCACAGTTAATCAGATGCCTCAAAGTAGCGATGACAG
TGAAGAAGAGGTGGCTGAAGAGAATTCAGTGTTTGGGTCTTTGGGAAGTCGAGGCAGCCT
AAAATTTGCTTTTGAAATGAACTCAGGGGTAGAGTGACATGGAGAATCCTGGTTTTGAAA
CAGCAGGAGGCGGCATTGGAGAGGCTGCTGGCTGCAAGCCAACCTGGCTAAGAAGTCTGC
TGAGAGGGACGGGAACAGTTGCTGGTGGAAGATGTCAAGAGCACACTGCTGGCCTCTCTT
CACCTCCACTGTCCTCCACGATCTAGATAGTATCCCTCCCTCAGCTTCAGATACGCTGTG
GCGGTGGTTCGTGGCAGGGTCTGTGGAGGCAGAGAGGAGGAGATGGGGAAGGGAAAGCCA
AGGTCAGGTAGAGAAAGGCTCACAAGAGCAATGGAGGGCACTTTGGAATCTTCCCAAAGC
AGAGATGGAGTAATCTTTAAGGACCCAGGATGTTATTCTTCCTCTCTTCCTGCCACTTTA
AGCTTTGATACCGCTGTGCTGTGTTGCAACCTCAAGTCTCATGACAATGTTGAGAGTGAA
TCATTGACAATGTTAGTCTGTACCCAGCTCTTGCCCACAGCAGAGTGGTGAGCTGCTGCA
ATGCCTGTCCTGGGGAGATTTCCATATCTTCTTCTGAAGGAATTTTTTTCCTCTTTTCCC
TCTCCCTTCCCTTCCCAGTCCTCTTTCTTCTTCCTCTCTCTGACCGTCTCTTTCTGTCTC
TGTCTGGGTCTCTCTGTTTCTCTTACTATTCTTCCCTCTGTTGATGTTGGTTTTCTATTT
TAGTTAACTTTAATCTCACCACCCAGGGTGGCAGTCATTAATTTCAAAACTGTTACATAA
GGTGGGAGGCACATGGCGTTCTGCTGTGGGAAGGAAGCTGTTAACACAGTTGAACACCTC
TTTCTTAACAAAACAGAAAGTGGGTATATATGTGACAGACAGAAGAGAGAAAAAAGAGAA
AAAGAAAAAAAAAGGTGGGAGACATATTGTGACACACCTTTTGGGGGCAAGGCACACTTC
TAAGAGGGACTATACCTAACAAATGCAATCAGTGTAACCTGGTTCTTGTACCCTCAATGA
ATCCCCAACAATAAAAAAAAAGAAAAAGAAAAAGAAAGGGTGGGAGACATGGCAGACTCC
GGCTTCGGGGTGATGGAGCAGCCACTCAGTGGCAGAGAACTTACCCCAGCTAACCTCCTG
GGCCACACTCGATGCTTTGTCACTAGCGCCTTCATTTTGCCTCATGTTGCCTCAATTAAC
TGTGAAAGTCAAGGTATCATTTAACACATGGCTGTGAGAATCACCAGGCCAAATGCTAGA
TTCTTTGGCGTATGCTGTGCTTAGGAACAACACAATTTTTCTTCACTTACCGTCATGACT
GCTAAAGAGAGGAGTATGGAGCTCTTGGATTGCAAGGCCCTGGAGAAGTGAAGACAGTTA
GGCAAATATTAGTTCATCCGCGGTGATCCTCTCCTTTGTGTACACTCTGAACTAAAACAA
CAGCCTCTTAGCAGAGTGGTTGAAGTTAAAGTGTTCTGACACACATCTAAAAAGGACCTT
TGAAACAGTCATTTGCCTCTGTGGTATACAAAGCCTCTCAGAGTTTCAGGGAGGAGGAAA
TTCATGTGCTCTTAAGGTGTCTGCTTCTTGCATGGGTATAAAGTGAAATAGAAGTTATTC
GGTGATACTGGGATTCTGAAGGTGATAAAAGACAAGGAAATAGTCTGGAGCAGGGTACCC
TCTCTGCTGCCAGAGAGTGAATACATTAGCAAGGAAATCCTGGACTTAAACGGGCTAAAT
TCATTATTTCTTTCTATTGCTAACATTTTGTTTGGATAACTGAAAAAGATGAAGTGGAAA
AGGGAACCATTCACGTCTCATAGGGGAGGAAAGCCCTGGTGGGGTCTGATATTGGAGAAC
ACATTTTTCTAGGCCTGTTCCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved