Otolemur_garnettii Locus Mono:74:SNORA5
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:74:SNORA5
Otolemur_garnettii
Mono:74:SNORA5
scaffold_99930
SNORA5
1001..1134
2134
GACACCAGTAACGAGAAACTCACAGAAATAATTTTCCTGAGGCATTTTCCAAAAACAAG
TTTAAACACTGGGCACTTAATTATAGACTAACATTTGGGGGATTGATTGCAAACCAATCT
AAAAGTCATTACAGATCCAGGTTCAGTCTCACAACCTCTAACAATGATCCAGGAGGCTGT
TTGGAGAATCAAACACCCTGAGGAAACTGTCTTCTACATTTCCTTCACCAGCAAATCCCA
TAAAGCTCTGTCCGCTCCTGGGAAGCTTCTTACCAGAGAAGGGAAAGGTCACATCCATCT
CTCTCTGCCCTGGGGCCCTCTAACTGCCTCTTGGGGAGAGTAAAACATTTCTAAAGATGG
GCCCACTGGGGTTTGTCTCTATGGATTCTACAAGGAAGAAATGGCTGATGGGGTCTGCTC
AACTACATAGTGGTCCAGATGCTACCGCTAGGTTCAGTGGAAAAGAAAAAAAGAAGAAAA
GACCTGGCAGATCACTGAAGCCCAAACCCATGCCTGTCCAGAAGCAGCTCACATAGCCAG
CTCAGGCCCTCCATCTAGTGGCTGCCTAGCCACACCCTCTCCTTTCCAGACAGTGGCCAA
GCCCTGAGATGATTCAGACCTAGATCCTAACTTCCTTTACCTTAAACAGCAAAGATAAAA
TCTGCTCCCTCACACCTGCCACACCCACACCTGTCCCAGCATCTTTGAGAGAACTGTGGA
ACATCTCAGCCAGCAATTCACTTAGTGTCACGATAAACTACAACTGCTTTACATACAAAA
TAAATACTTAAACAGATTGTACCCTTTCACTCTTCAGAAAGGTAGCCATGGAAATTATTT
CAGAAATACTGTTTTCTTTCAACTGCCCACCTTACAAGGTTTTTTAGAATAAACTAACTG
ACCAAATACCAGCTCCACCAAGTTGGCTAATAGTTAAAATTTCTACCTTGAAGTTTTCCC
CTTTAATTCAAGGTACTTTTTTTTTTTTAAATTCAAATACCTGCAGCTGTGTCAAATTCA
GTGCCTGCCTTACCCATGGTAGGCACTGGCACAGAAGGTTGCCATAGAAACACTGTGACT
CGTGGGCCCTGTTCCTGTGTCCCAGGCTCAGGGATAAATTTGGTTGCTGACAGCAAGCTT
CTAGACCTCGATACTGGAGTGAGGCTCCTCGTGAGCTCTGGACTCTCGGGTCCTGTTAGA
ACAGGATGGGGAGCTAACTCTTCTTTGAAGAGTTGTAGTAAATGCCCATGAGAAGAGGTT
CACAGAGGTTCCCAGCTCACACACAGGACCAACAGGATGCCATATGTAAAAAAATAAATA
ACATAAGTAAAATTCAAATACCCTTTGGGAGAAGTTACCCATTATAACTTGACAGCTGTT
TGTACATGGATGTGAATAAGCAATTCTCTTGATGCAAGAAAGTATAGAAGAAACAGTAAA
CAAAAGTTCAGGCCACTGATTCCATGACATCACAACTCTGTCTCCAATAAAAAGCAGGGA
TAAGCATTATCAAGTAGGTATCATCCCAGGGGTGCAAGGCTGGTTTAACATACTCAAGTC
CATAAATGTTATTCACCGTATCAACAGAAGCAAAAACAAAGACCATATGATCCTATCAAT
AAATGCAGAAAAAGTATTTGATAAAATCCAGCATCCTTTTCTAATTAGAACACTGAAAAG
CGTAGGCGTAGGTGGCACATTTCTTAAACTGATCGAAGCTATCTATGACAAACCTATAGC
TAATATTTTACTGAATGGAGTAAAACTGAAAGCTTTTCCTCTTAGAACTGGAACCAGACA
AGGTTGTCCTCTGTCACCATTACTGTTCAACATAGTGCTGGAAGTTCTAGCCAATACAAT
TAGGCAAGACAAGAAAATAAAGGGCATCCAAATGAGAGCAGAGGAGGTCAAATTCTCCCT
CTTTGCTGATGATATGATCTTAGAGAACCCCAAAGGCTCAACCACAAGACTCCTGGAAGT
CATCAAAAAATACAGTAATGTCTCAGGATCTAAAATCAATGTCCACAAGTCAGTAGCCTG
TGTATATGCCAATAACAGCCGAGATGAGAAGCTAATTAAGGACACAACTCCCTTCACCAT
AGCTTCAAAGAAAATGAAATACCTAGGAATAAATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved