Otolemur_garnettii Locus Mono:484:SNORD56
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:484:SNORD56
Otolemur_garnettii
Mono:484:SNORD56
GeneScaffold_3722
SNORD56
1001..1071
2071
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNATAGAGGCTTGTTCTATCTGAATGAGGAGAGCATCTGAAGTTCCAAGGTGGGCT
TTTACCAGGCAAATGGGATCAGGCATTGCAGCTTGTCCTCCTTCTGATAAGAGTGGCCCT
TGGAAATAGGCTTAAGTTAAACCCCTAAAACTTTATTAGGACTATGATGATGGCACTATT
TTTCATCAACAGCAGTTCACCTAGTTAGTGTTGATACTTTGGGTCTGAGTGAAAAAACAA
AAAGTTTGTGAGGAACCCTTCCTAACACACCAAGGTAAGTATGGGGATATAACCATGACT
GAACAAGCAGAGAATTGCAATATGACAAGGTCAGATATTAACCACTATGCATGAGTTCCC
CTCTTTCAGATCCCCATCACAGTTAGAAACAGAGAAGTAAAAATGACCCTCTGAAGTGCC
TCTAATGACTCACACCTTGTAAAAATTGTTAGATGTGAAAATCATAGGTCCATCAAAGCA
AAGAGGCGTCCCAGGGGAAAAAGATGACCCAAGTCCCTGGTGGGTTGGCCAGCCATTAGG
TAATGTAAAGTAACTGTTTAAGAAAAAGTGAAAAAGGAAAATGTTTATGTGTGTGTGAAG
AGGATGCCAAAAAAGTATACACATTTTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTC
CCCCTGGGCAGAGTGCCATGGCATTACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAG
CGAGTCTCCTGCCTCTGCCTCCCAAGTAGCTGGGACTACAGGCACCCGCCACAGCGCCTG
GCTATTTTTTGGTTGCAGCCATCATTGTTGTTTGGTGGTCCGGGCTGGGGATTCGAACCC
GCCACCTTAGGTGTATGTGGCTGGCGCCTTAGCCGGTTGAGCTATAGGCGCCGAGCCAAG
TATACACATTTTAAGACAGGAAAAAACTGTATTGAGTTTGTAATACTCAAGTCACATTTG
ACTTCTGCAATTACAAGAGGTTCTCATTGTGACTTGTATTCATCTTTTGTTTTCAGTATG
TTATTATAATTTGAATGCAATGTTTTCCTTTCTTAAATTGTGTATGCATTTTTTTGACAC
CCTCTGTATTACCTAACTTCTCTTTGATTATTTATTGTGTCTACAGGTTAGAGAGACAAC
TCCTTAGTGAGAATTTCTGCAGGCTTTCACCTCTTCTGTTGATCTGTCTTGCTGCTGGAT
TTGTCATTCTAAACCTTATTTGGTGCTACATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved