Otolemur_garnettii Locus Mono:243:SNORA32
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:243:SNORA32
Otolemur_garnettii
Mono:243:SNORA32
scaffold_81895
SNORA32
1001..1113
2113
AACAGATGGATGAGATGACTTCAAGCTAGAAAGCTCCCGCATAGCCAAGGAATCAATCA
AATGGATGAACAGACAACCTATACACTGCAGAAAATATTCCTAAGCAGCGCATCAGGTAA
GAATTTAATACCCTAAATAAACAGGAAATTCAAGCACACCTTGGTAGGTATAAAACATAT
AATCAGATTAAAAAGTGTCAAGAAATATTAGACATTTCTCAAGAGAGGAAATACAAATAG
TCACCAGATATATTAAAACACGCTCAAAATTACTTATCACCAGAGAAATGCAAATTAAAA
CAGTAATGGGAGATCATCTTTGACTTGTAAGAATGGCTATTATCCAAAAGAAGAAAGATA
ACAAGTATTGAGGAGGATGTAGAGAACAGAGAACCTTGCACAGTGTCAGTGGGAGTATAA
ATTAGTAGCTATGAAAAACTGTATGAAGCTTCCTCAAAAATTAAAAAGTGAAAATACTGT
ACGTTCCAGGATTCCCACTATTGAGTATACACACAGAGGAAATGAAATCAGTTTGTCAAA
AATACAGCTGCACTCCCACATTCACTGCAGCAGTTATTCACAATAGCCAAGGTATGGGAA
CCAACCTAGGTGTGCATCAGTGGATGAATGGATAGAGAAAATGTGGTATAGACATAACGG
GATATGAGTCAGCTTTAAGAAGGAAGGAAATCATGTCACTGGTGACAACATGGATGAACC
CAGAGGACATACGCAAAATTAGAAAAAAAAAAATTGGCATAGAAAGAAAAATACTGCATG
ATCTCACCTGCAGAATCTAAAGACATTAAACTCATGTAGAGAATATAATGATGGTTACCA
GGACTGGATGCAGGGGGTAGCATGGAGATGTCAGTCAGGGGATACAAACTGTGAGTTAGA
TAGGAGGAATAAATTCAAGTGATCCATGGTACATTATGGTGACTGTAGTTAATACCAGTG
TATTGATTGTAGTCTGGAAAATAGCTAAGGGTAAATCTTAAGGGTTTTTGCTATAAAAAG
TAAGTATGTATGCTGAGGACATGACCATAAAAAGATTGTCTGCTAGGTTTTCTATCTGCC
ACCTTGCTAGCAATTCGGTCTATTGGGAACATTTTATTAACTGTTTATTAGATTGTTGCT
TATTTTCTCTCCACTGACTAGTTGAACACCGTCCAGTAGAAATCCAAGGCAGCCACATAT
GATTCTCTAATAGCTACATCATAGATAATCACTGAGGTTTTATGACAGACACATTTCACA
TTCTCACTGAACACAGTGCAGATCTAGATTTAGAGAGCCTTGCAAATGTGCCCTGCCCAG
CTAATTCTCGTTTTAACACTTCTGGATTGTTTATAACCGAGTAGTTTGTATAGATTCATG
ACTTACTTATGATTTCACTGTACAATCATCTGTGTAAGTGTAAGCTTACTTTTATATCGT
TAATATGTGGAGTTGAGAGGACACTTGGGAACTGAGCAGCTGTTCTATTAAAAAGGTCTG
TCTCGAAGACAAACCCTGACTCCAGCTTTTGAGGAACTAAAGTTACCTTTCTGGACAGTG
GAAAGAATCATAATGTGTGATATTTTTTGAATAAAATTTTATCAAATTTAAATAATTTTT
TAAATAAATTATCTAATGCCATAATAAAAAAATCTTTACATTATTTGTAAAATAAAGGCA
TATACATTAATGTATTTGTTAATTATCTCAAGTTATCTATTCCAATAAGTATACATATTC
CACACAGTATACATATTTCAAAATGTACATAGTAAATATATATTGTATTCATGAAATAAA
ATAAATAAAAGAATTAGTAGCTATGAGACTCTGTGATACTTTTTCTTCCACACTTTCTGT
TTCTTTTTTTCACATGTACAATGAGAAAATTATTCATTAGAAAATCAAAGATGTATAATC
TAGACTAAAATATTGAAAAAATTTACTACAGTGAACAGGACAGAGGAAGGATTCAAAAAT
GTTAGCTATTATTAGCACAAATGTAGAGGAAATAGGAGCAATGAGAAAAAGATAACAGTG
ATATTGGAAAGGACAACAGCTTTTCCTAAAAATGAATTTGTTTCAAGATTGAATAATACT
TGTTTCTTTCTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved