Otolemur_garnettii Locus Mono:123:SNORA51
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:123:SNORA51
Otolemur_garnettii
Mono:123:SNORA51
scaffold_108824
SNORA51
1001..1126
2126
GGGGGGGGAAATGAGCTCTAAAGCCTTTAGTCTATATTCTTCAAAGAAACTTTACATAT
TTCTATTAACGGTGTGAAGTCCCTCAGGAGCTGATGCTGCAGGATAAGAATTACAAATGC
AAACAATGTTACCTAATCATATTAATCAGGAAAAAAAAGACATCTCCCTAAAAGGTTGTG
GCATAGTATACACAGTTTTAAACAGGAAGTTGGATGCCGTCTGGCTTACAAAATCCAAAA
CTCATGAATAACAAGACAAGTCATAGTCTTGAGGGGATCTTTTGAAATGTGAAGTACCTT
TCCACATGCTTTTCCGTCTCCCCTAGATACTTTTTTCTAGTAGTACTTAATGGAATTTTA
GTATTAAAATTAATGAATGCTTTAAAAGATGAAATTTTATTTGTGTATCTAACACAGCAC
TAAAGAATAAGCAATTACAATATACGTTGACTTTCATATATTTGCAAAAGTGTATTAGTT
TCATTATATTTGTATATACATTTATATTAAACTTTGTCTTTTATACATTAAAAAAAAAAA
ACAGGAAAGTGCAAATGCAGTCCCCACTACCAGAGATTATAGAGTAGTGTTTCCCACATT
TGGGGAAACCACAGGGGCCTGTACCCCCTTGCCCTCGGAAAACCACCTTTATGATTATAG
TATCTTTCCTGCCTGGTACGTGTATAATACTCTATTAGAATATAATGTACACCATTATGT
TTCAAGTTATATTTGTTATTTGTTTCTTTTAAGAGATTCGAAGTTAATTTAATTTCTAGA
CTTAAAATATAAAATCCTTTTGGGGTGGACACAAATATAAGATGGTTCTTTTCTAACAAA
AGCAATCAATGTAACCTGGTTCTGTGTACCATCAATGAACCCCCAACAATAATATATATA
TACACACACACACACACACACACATACAATTGAATTGTATATAAAATTCAATTTTAGGCT
CAGTTGCTGCACTAGGCCCACTTAGAAATCACAAACTTGCCGGCTCCCTAGTTCTCCCTG
CAGGCTATGTTCATATACTGACTGTATAGAAAGAGGAAACAGGTAAAACCCATAGACACT
CCAGCCCAACCCTGAGTGTAGTCTGTATTTTGACTAGGGGAATATAAGGGAAGAAAAAAA
GAATGAAAGAAAGAAAACACATACTTGCCCTGAAGTTGAAGAAGGATGGTTCTTAGGAAA
ATTATAGTTTGATTCCATTAATCTTAAGAAGATAGAAAAATATCCAGTGTAGGTCACTGG
TCTGTCTTTTCACTGCCAAATTGACAGGCTATCTATAAGGTCATACTTGACTATTTAACC
CAGTCGAATTGTCTTCTTTTATTTTCACAGTCCAGTAGTCTCACCATTAATTTCCCTGCA
AATTAACCTTTGACATTTCTCCAAATGATCCCATGCTAAAATTAGCAATTCTTATTCATT
GTTTTTTAGTTTAAAAATCTGTTTAAAAGGCTTTGAAAAGTATAATTCACACATCATAAA
AGAATCAATAACATTCTCTTGGTGTCAAAGAAGTATTCTACCAAATGGAAAATGCACAGA
TATTTCTAAAAAGAAAGAAATGGGGGACACTGACACCTTCAAATGTAAAAACTGAAATAC
AAAAACAAATTTTTAAAAATAGTATAAGCTTTAAAGACATTGCAGTCAGCAATGAGGTGT
TAAATTGCGTATTATTCAATTTATATGAAGAAGGATGCAGCAAATACCCAAAGTGCCTCA
GGACATAAAATGGTTATGGTTGGCAGTTTGATGAGATTCAAACTCTGTGGAGAGGAATTG
TAGAATGAATTTGTTATATCAAGGTAAATCTAAAATAAGTGGTTAGATATTCCCAGAGCA
CTCAGAATGGAACAAAAATCAGATCCTTTTTCCCCATTACACAGTCAGAGGACAGGCACT
GTGCATCAGTTCTTTGGGTTTCTCTACGTAGAACAACACAGGCAATATTCCTGCACAAAA
GGTGACTCACTGCTCACATCACGGCTGCCTTATTTTTGACTTTGTCATAACCCTTTGCAG
AAATGAGATGAAAAGACTATCATCTAAAAGAAGTAAAAGAGAGAAATTTCATTCAGTCAA
CATAAGAGTATCACCAAGATGAAGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved