Otolemur_garnettii Locus Mono:78:SNORA71
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:78:SNORA71
Otolemur_garnettii
Mono:78:SNORA71
scaffold_100254
SNORA71
1001..1128
2128
AAGTAATGGTTTTCTTTTCTTTCTTTTTTTTTTTTTTTGAGACAGAGTCTCACTTTGTC
GCCCTCAGTGGAGTGCTGTGGCATCACACAGCTCAGAGCAACCTCTGACTCCTGGGCTTA
GGTGATTCTCTTGCCTCAGCCTCCCCAGTAGCTGGGACTATAGGCGCCTGACAACACCCA
GCTACTTTTTTGTTGCAGTTTGGCCGGGGCCAGGTTTGAACCCACCACCCTCAGTATATG
GGGCTGGTTCCCTACCCACTGAGCCACAGGCGCTGCCCAGCAATGGCTTCCTTTTGATAG
TAAGCCAGAAGATTTTGGAGAGGCACAGAGAGGGAAACAGGAATACAAGCACCGAAAATG
CCTGGTCAGAATTGTCCAACAGGTTTGGGGGCTGCAAATCTGAGGGAAGAGATAGATAAG
TAAACGTGCCATGCTCTACTGATCCTTTTATTTGCTCTTATTTGTTTATCTGCTATTAAT
CTTTGCTTTTAGCTCATAATGGCTTTTTAAGTTGTCTGTTAAGAGCAGCATTTTCTTGGG
ATATTTGTTACCATTGTTCTTCTGTGTCAAACTTTATCCAGTGTCGGGAGGTTCTTCTCC
CCAGCTTCACGTTCCAAACACAAGGCTTTGTCTTTGTGTCTTTTTTTAACTCAATGAAAA
ATGAATTAGAATATTCACTGAAAAACAAAACACTTTGTGTTGGCTCGGTGCCCATAGCAT
AGTGGTTACGGTGCCAGCCACATACACCGAGGCTAGTGGCTTCGAACCCAGCCCAGGCCA
GCTGAACAACAATGACAACTGCAACAAAAAAAATAGCCAGGCATTGTGGCGGTCGCCTGT
AAGTCCAGCTACTCGGGAGGCTGAGGCAAGAGAATCACTTAAGCCCAAGAATTTGAGGTT
TCTGTGAGCTGTGACACCACAGCACTCTACCGAGGGTGACATAGTGAGACTCTGTCTCAA
AAAAAAAAAAGAAAAAGAAAAAGAAAAGAAAGAATTTCTGCACCTGCATCCGAAAGTGAG
TGTGGGCTGCTTGTGCCGAGGTCAGTTGGTTGTTTGGGGAGAGGAAAGCTGAAAGAAGTT
TTCCTCGCGCTTGGAGGGGCCGTTTGTCCCTTCCTGGAGCTTTCACACACTGCGGCAAAA
CAAACAAACAAACAAAAAAACACATTGTGTTAATGCCTTTAAAAAATTAATTTTTGCATA
GCCTATTTCATAGCTCTTATTTTTTAGAAAGGAACATTTATTTTCTAAAAAGGAATGTAT
TTTTCTTGCAAATGATAGACCATAGACGTCTTTATTGATAATCTTATTTTCTGTGGCTAG
ATATTTTCTGCACTTGCTATGCTTATATCTAAGAGAATAGGACATGTTCTCTATTTCCTA
TCTTCTTTTAAAGGAAAAGAGTTGGCTACTGAATTAGAAGGTAGTCATTTAGTGCCTTAT
TTACACTGTAACATTGGCCTGGTGTTTTATGCTTTTGTGTGAAGGAAAACAGCAACTGGA
AAGCGTTTTAGAGTTGTGGCAGGAGTTATATTAAAAAGTCATGTTTCACATCATTACAAG
CATGTTTTGTTTGTTGCATATTTTTTTTAAAAAGCAATAATAACAACCTCCCCCCGCCTC
CCCCCTTTTTCTCTAATGCTTTTTCTCTTTTGCCCAAATCTAAAGTCAGTTTGGAGGCAG
TTAGCAGGAGATGAAAGAGATTTGCTGTGGAAGCTGGAATATTAAGTGGCCTGGCAAGCA
TTTGGATTTCTCTCTCAGGAGGAAAGGAGAAACATGCCAAATTCTTACCATGCTGAAAGA
CAGAGACTAACTGGGGGTGATTTTGAAAACATTTTATGCTCATGAAAACAAATGTTTGTG
ATAATTACCACGGAACTCTTCTCTCTCTGTAAAACCCTAGATTTTGCAAATAGGGATTTA
AAAAAACATGTATTTGGAAATATGTGTAAAATTAATCTCCTGCTAACTTTCCTTCAGGCC
CATGACGTTTGTGGGTTTTAGCTGCTACTCACTTTCTTTTCTTGGTAATGCCATTTTCCA
CTCTCCAATTCCTGTCAATCCTTGTTAAGCATCAGTTTAATCAAGACAGAATTCTAAGCA
TAGTAGGTAAGCCAAAATCCATCTTTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved