Otolemur_garnettii Locus Mono:203:SNORA70
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:203:SNORA70
Otolemur_garnettii
Mono:203:SNORA70
scaffold_66050
SNORA70
1001..1116
2116
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACTAAGTCAGAGGACAGACTGTCCAATTT
CAAGACGTTTATAAATGTTTGATAATATAGGCAGTGTGGCACTGGTGAAAGAATAGACAA
ATAATGGACTAGACAATGCCTGCAAACAGCAGCCTCCTTAGTTGTGCACGCAGCCTGTTG
TTTATATAGGTTGCTCTAAGGGACCTTGGAGACAGTCCTTTCCAATACATGTTCAAATGT
CAGTCCTTGTCCTGTTCAAATCTAGGCTCCAAACTAGGTATGTGTGGTGCCTTTGGAAAG
CCCCAGGGCAGTGGCCAGGGTTCACTTTAGCCAAGCCATCACACCCATCTGCACCAAACT
ACAGAATAGGCACATGTGATTGAGGCCCTTTGCAGGGCCATGTTCAAGTTCAATGGCCAC
CAGACAATTCTTATCTCCCAGAAATGTGGCTTAACCAAGTTTAACTCAGATGAATTTGAA
GACACAGCAGCTGAGAAGTGGCTCATTTTAGATGGCCGTGAGGTCAAATACATCCCCATC
GGTGTCTCTCTGAACAAGCGGTGGGCCCTGCACTCATGAGGACTTACACTGTGCTGCCTC
TCATTTGTACCTCCCAATAATAAATCCTACTTCCTGTCCAAAAAATAAAATGAAATAAAG
TAAAATAAAGGAATAGAATGGAGAGCCAAACATAGACCCACACAAATGTGGTGCAATGAT
CATTAAAGAAATTGATCTCTAAAAGGAACAAATTCAATTAAGAGGAGGGATATTCATTTG
AGCTACCTCGTTCAGTCGCTGGAGCAACTGGACACACACCTATAGATGATTCTGGACACA
AGTAGAAATCAAAATCTATAAAATGGTTTTGAGGGCTACGGGCCCATGAAATATATTGTC
TCTCCGTGCAGAAGTCATTAACTGATAAAAATTCTGCCATTTACACAATTTTGTGTAAGT
CTTTTTAATTTTCACAAACACTGAAGAGGTTGAAGACTTGGAAGTACAGCACATGTATTT
ACGGTAATAAGTTTTCAGGACCGCCGAATAATTAGCTGTTTTGATTAGCTGTTCTTTTCA
CTGAATACATTTTTCAGAGTATAAAATAGGTTATTTCTTTTCTAGCTTTGTATATTTTTT
GTAAAGATAATCTTACATAGAATGTCGAGTGTTGTTTAAAGTCACATATAAAATTTGAGT
CCATTTTGTTAACTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved