Otolemur_garnettii Locus Mono:421:SNORA3
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:421:SNORA3
Otolemur_garnettii
Mono:421:SNORA3
GeneScaffold_3232
SNORA3
1001..1131
2131
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCAGCAGGTCATCTGCTCATCCTTGTTTTTGCTCATGCT
TTACCTCTGCTATCTCAACCTCTCTCCTGCTATCTCACCCCCCTCCCTCTAATCTCAGCA
AACACCCAAATGTCCTGCCCTTTGATGAACCCACTCAGAGGGCTGCTTACCTGAGGAGAT
TCCCCATGCAGTGCCCCCGTGAAGCCCTGTTTCACAGACAAGGGTTAAACATTTCCTACT
TGTGCTCCCAGTGCTGTGTGCACTTCTCTGCTTGAAGGCTTGCCTTGCTGTGACAACTAT
TAGGTCAAAAATAACTGAATACCGGTTCAACACCAAATGTACTTACAGGTTGGTGTCTTC
ACCAAACTGAACTCCTGAAGGCAGAGTTTGGTTTTTATCATCCCAGAGCCTGACATATAG
ATGATGCTTAAGAAATGAATGAGTTAGGAAATGAATGAATTGCCGAGACTAGAGTCACAT
CTTGACACAACTCTTGTCCCGGTGTGCTAGAGTCCTTGAAGAGAATCTGCTGGTCTTGAT
TCACTGGCAGGGGCAATCAGTGCCCCCGTTAGTGCCCAGATCAGTAACATTCCCTCCCTG
GATTTTAGAAAGTGGGTTGGCAGGCGGTGCCTGTGACTCAGTGGGTAGGGCGCCGGTCCC
GTATACTGAGGGTGGCTGTTCAAACCCGGCCCCGGCCAAACTGCAACAAAAAAATAGCCG
GGCATTGTGGCAGGTGCCTGTAATCCCAGCTACTTGGGAGACTGAGGCAAGAGAATCGCC
TAAGCCCAGGAGTTGGAGGTTGCTGTGAACTGTGACACCATGGCACTCTACCCAGGGTGA
CAAAGTGAGACTCTGTCTGTACAAAAAAAAAAAAAAAAGAAAGTGGGTTGGCAAGCATCT
TTTCTCATATGCATGGGAGTTGGTACTTGCTGTAGAGTATTGTAAATTATTTTCTTTTTC
CTTCTAAAAAAAAAGAAAAGAAAAGAAAAGAAAAGAAATGAACGAATCCGTGAGTACATC
CTCATGTCGGCTGCACTGAGTTTGATACAGATTAAGGTAGATTGACTTTAATAGGCAAAG
TTGAATCTTTTTATCTTTTATGTCCTTAAATACGTTTCTCTTCTTCTCTCGTAGAAGGAA
AATTTTTCCAAGGATGGTCTCTCACTCAGAGCTGAGGAAAATTTTCTGCTCAGCAGATGC
AGTATGTTTTTGATGTCCGATAGCACGGGTTATCAGAGAAGAAGGGATTGAATGAACTTG
GCCAGAAATCTGTGGGAGTTTGAGGATGCTGTTGTCGGAATATGTAGGCACCATTACTGA
TTTACTTTTATGAAAGTTATAAAGAATTTCTAAGGGAGTTATCTGGTTCGGTAAGACCAG
AGCCCACAATTCCCTGGTTTTAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved