Otolemur_garnettii Locus Mono:259:SNORA50
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:259:SNORA50
Otolemur_garnettii
Mono:259:SNORA50
scaffold_57363
SNORA50
1001..1136
1549
GGGCCAGAAGTATTTCAGATTTTGGATTTTTGGATTATTTTACACTACTTATTTGCTAG
TTATGCATTCCAAATTCAAAGATCTAAAATCTGAAATACTTATTGGAGCATCATGTCACC
ACTCAAAAAGTTCCAGATTTTAGAGCATTCTGAATTTGGAATGCTCAACCTGTGCTAAGA
ACCTAAGGTAGGAAAGTGAGTTTTTACGTCAAAATTTATCCTACTTTACATTTGTTTTAG
AGGTCAATAACTTCTTACAGCATGTAGTTACTGGCTAGGTATGGTATTTTTATCTTTATT
TAGTATCTTTGTTTTATCTTTGACTATGACGTAACTAGTGTAAAAATTGCTTGCCAGTTT
GCTTTGATGTGTCTAGATTTGGACATAAGTTTTGACAGAGTGGTTGAAGATATGGAATGT
TTCTTGGAGAATTTTAAAGTATATTGGTTGTATTATACTCAGGCAAAAATTTAGCCATGT
GCTCTAGTAAGTTTTCTTTATTAGAAAATCAGATTGGTTTATGTAAGTGTTCTGGGGAAT
AGCAGGTAATTCTTTTACTTCTTTCTTTAGGAGTGTTTCTCAGGAGTTATCAGAGACCAT
TCTCACCATGGTAGCCAATTGCAGTAATGTTATGAATAAGGCCAGACAGCCACCACCTGG
AGTTATGCCAAAAGGACGCCCTCCCAGTGCTAGCAGCTTAGATGCCATTTCTCCTGTTCA
GGTAAATGAATGCTACAATTGCTACATCTGCATTTGTTCACAGACTTGGAATAGAATAAG
CTTCTACAGCATCATTAATAAATTGTCTAAATTTATTAGAGATAACTGCATGTCTTGCAT
CCACTTATATTTTAAAAGAGATCCATAAATAGGTATTGTAGTTGAGAATTTTAATCATGA
AATAGAATGTATCTGAGAGTAAAGATGCAAACAAAACAATTTATTTAGGTAACTGGAAAG
GTTTCTTTTTAAAATAAGTTTGACATATACTCTGGAGAAATAAGCACTGTCTTTGAACCT
GATGTGTCTTGTTTGTAGCTTCACGGGCCAAGCAACAGTGCTAGAGCATAACGACTTGTT
ATAACTGGGGCTCTTCAGCTCTCAACTGAACTGCTCTTTTAAAAACAAGGTACATTTAAG
TTACTCCCTGACATCGACCACCCCCTTCTTTCTGGGAGCAACATACTGCGCTTCTATTTT
CAGCTGCATTGAATGGCAGTTTGGGGTTTAAGGAAAGAAAGAGACATTTTGTGATTCTTC
AGTGGCTACTTTATAATAGACATTAGCTTGTCATTTTCTATAATCATGAAGGTGTATAGT
AGTACCACACACTGTGAGAAGCTTGGATGTGTAGTTATTATTTTAAAAAATATTCATTTT
GATGAATAGCATACCTTGTTTTTGTTTTCAAAATCAGAGCTGATCTTCCCCATCTCCCAT
AGTTCTCAAGTTTTAACTACATTTAATTTCTAAGTTTTAATGTTTTCATTTGTGTTAAAA
GTTAAATAACTTAGCTTAAGATATTTGTTTTAAAGTGGCTTATTTGAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved