Otolemur_garnettii Locus Mono:285:SNORA70
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:285:SNORA70
Otolemur_garnettii
Mono:285:SNORA70
GeneScaffold_1608
SNORA70
1001..1121
2121
CACTTGCATATTTTTTTATTAAAAAAATTTTTTTTCCTGAAAAATTGGCCCTTGTGCAG
AAAAGGGAATATAACTTCAGAATGCCTAAAGGCTTGTGGCTCTTCCCACTTTCCTTCTTA
TTCTCTCTTTTCCTCTTCCTTCAATTCCTTTTGTCCTTTGTGCCTTTCCTGCTAATCCTT
ATTTGAGTATTAGAGGTGTCAGATGAGAAGGACTTTAGCTGAGGTTAAGCCTTCTCTTAG
GATTTGCATTGTAATTGAGTGCCTTGGAATACCTTCCATACTCAAAATCAAGTGAAGTGA
GGAAGATGGAGCTTCAGGGAGCTTAGCTGGTGCTCTGAGTAGGACCCTAACCAGCCTCCA
TGAGTGACATAGTCCCTGCATGCTGTTTGTTCTGCACAGTAGCTAGTATTTGCTGAGGCT
GCAAGGCCTCAGATGCCTAGGCTTCTTCCCTTGTACTTCTGGATATCCAGCCTGGTATTA
ATTGAATGCTAAGCAGTGGCCCTGGAGTCATAGTCTAACTGGAGACAGACAGACCCAGGT
AAGAGAAGCAGAGAACTACTTTGGAAAATAATTTATCTCCTGTGTCTGAATGTTTGCCTA
CCCTATAACCCAGTTATTCTAATGTAGGGGATAAATCTTAGAGAAACTTACACATGTATA
CCAAGAGACATGTACAAGAATGTTCATAGCAGCCCTGTTCACAAAGGAAAAAGCCTAGAA
ACAACCAAATTATTCACAAGCAAGAGAATGGATGAATAAACTGGAATATTCACACATGAA
ATATGTGCACATACTACATAAAATTATTAGAATGACAGATACCTAATGGATGAATCTTAG
TAATAAAATATTGAGTGAAAAAAGTTTAACTCCCAAAGAGTAACTATAGCACGATGTCTT
CTTAGAGTTTTCTTTTTTAGTAAGTTATTATTTACCTATAGTATAATTAATTTTAAATGT
ACTATTTAATGAATTTTCATAATTGTATATAGTATAATAGCCTTCATCACCATCACGATG
TAGAAACTACTTGGTGTGCAATGGCTCCAAACAGCAGCCTCCTTGGTAGTATATGCAGCC
TGTTGCTTGTATGGGTTGTTTTAAGGGACCCTGGAGACAGTCCTTTCTGATGTATGTTCA
TATGTCAGACCTTGTGCTGTCCCCAGTCTAGGCTCCAGACAGGTATGCGTGGTACCTTTG
GAAAGCCCTAGGGAACTGTGGCCAGGGTTCACATTGGCTGAGTTATCATGTCCACCCATA
CCAAACTGCAGAAAAAAGAGCATATAAATGAGGGTCTATGCAGGGCCAAGTTGAAGTTCC
CTCACCGCCAGAAGATTCACATCTCAACGAAATGGGGATTTACCAAGTTTAATGCAGATG
AATTTGAAGACATGATGGCTGAGAGGTGGGTCATACAGGATGGCTGTGGGGTCAAATACA
TCTCCAATTGTGGCTCCCTGGACAAGACGAGGGCCCTACACTCAAGAGGGCTTCCACTGT
GCTGCCCTCTTATTTGTACCAACCAATAAATCCTACTTCCTGTCCAAAAAAGAAAATAAA
AGTATAAAAACTAAATCTGTTTCTGAAAAGTTTCCTTGGCTTCCTTTTTACTGACTCTTT
TTCCTGTCCCTACTCACACTGATCTGCCTTCTGTCACTATATGGCTTGCCTATTTTAGGC
TTTCATATTGTGGAAGATAGAGTTGATTAACAGCTGGATTGCAAAACTGTCTGTGAGACA
CCTGAATGTCTAATTTTCACTCTTGCTTAAGATAAGGGCATTGGGATTTGTAATGTGCTG
TTTAAAGTCTAAGTTCCTTTGGTGACCCCAGGTCACTCCTCTTTACTGAGAATTTTAACT
GTCTAACCAGTGTGTCTGGCTGATACTAGTATAGTAGTATAAACCCTACTGGAACTTACT
ATTTGAGCTTTCCAGAGCCAGCAGGATTCTCACTCAGGACCCAGTGATCAATCCAAAAAC
ACCTTACAGTGCAGTCCACCTGTGAAAAAAGATGGTGGGGGAGCTTGTCCTTGGAATGTT
TCTCTGATTCCTATTATTTAGTCTTTCTCTTGCTGCCCAGGGCCCTTTGCCTTTATTTTT
ATTTATTTATTTATTTATTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved