Otolemur_garnettii Locus Mono:14:SNORD45
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:14:SNORD45
Otolemur_garnettii
Mono:14:SNORD45
scaffold_88916
SNORD45
1001..1084
2084
ATTTACATTACGATTCACAACAGTAGAAAAATTAGAGTTATGAAGTAGCAACAAAAATA
ATTTTATGGTTGGGGTTCACCACAACATGAGGAACTGTATTAAAGGGTTGTGGCATTAGG
AAGGTTGAGAACCACTGCAACAGAAGTGTCATCTGCTCCTGGCTGAATCCCTGCATTCTA
ACTGAATAGGCTAAGAAAGACAGTCCTGGTTTCTGCCTTGAGCCAGGTCTTATAACATGG
GGAACTTACCAAACACAGGAAGGGTTTTTAAACAAGTTTAGTGACCCAAAACATGACAAA
GTCTCTTACACTGTGTTCAGGTATATATTTGGCATTCAGGAATAGCACCTCTCTTGAACA
AATATACTGAGGTTTTGGAAAGAAAATAAAGAAATAGGAGCACATAACAGAAATATTGCA
TATGGCTCGGCGCCTGTGGCTCAAGCGGCTAAGGCACCAGCCACATACACCTAAAGTGGT
GGGTTTGAATCCAGCCCGGGCCAGCCAAACAACAATGATGGCTGCAACCAAAAAATAGCC
AGGCATTGTGGCAGGCACCTGTGGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGACTCTC
TTGAGCCCAGGAGTTGTAGGTTGCTGTGAGCTGTGATGCCACAGCACTCTACCCAGGGGG
ACAGCTTGAGGCTTTGTCTCAAAAAAAAAAAAAAGAAAAGAAATATTGCATAGACATGGT
GAGAAATTAAATTGTACCTGAGAAGAGATGACCCTGAAAATTATCAGATTAGCATAGATA
ATTTTGAAGATGGTGATACCAATGACCAAGGTAGGGATCTCAGAGCTGAGACAGATTCAG
GGAGGAATTGGTGAGACAGAGAGTTTGATTTACAACTTTCTAGAATTTAAATTGTATAAG
ACTTTGGAAGGACTAAAGTTAGCAGATCCATCAGTATTCATTCATCATCTCCTGGTACAG
AATAAAGGGTAGCAAAACTTACATTTATAGATGGAACTTAGGGTCAAGGTTGTGTTGACA
GATATTACCTGAATTTATTGCTGATGTATAATAACACTTCAGCTCTCAAATTATGCTTGG
AACTTCATAAAAAAAAAAAAAGGAAAAAAAATACCCAATAGCAATAGTTTAAGAAGGTAA
AATAAAATAATTGATTGAGTTAGAAAAAAAATCAATAAATGTAATTAAAGGACAGGTGTA
ATTAAAAGGCATATTCAGCTTGGTGGCGCCTGTAGCTCAAGCAGCCGAGGCGCCAGCCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTACCCAGGTAATAGCTTGA
GGCTCTGTCTCAAAAAAAAAAAAAAAAAAAAAAAAGGCATATTTAGCATAACATCACCAG
AGATCATGCTTTGATTTTAACCTTTTTACTCTAAAAAAATGGCAAAACTAGGGAGGATTA
CGAAAGCAAAACATGGTTGGCTTTCAGAAACTATTTATAGGGAGCTTATCATGCTCCAAG
AATTATACTAAATAGTTTACATAAACATTACTTTGTGTTCCTTTAAACAATCCAGTATGA
TAACATCTTTGTTCTCATTTTGCATATGGATAGACTGGGTCTTGGGGTAATTCAGTAACC
TGTCTGCCTGCAGACAGTGGGCTGGATTCAAAAGCCCATGGTCTGAACCAGAGCATGATA
TTGCTTTCAGCACTCAATTATGCTGCCTTCACTCTGTGGCTGGAACTCACCCACATGGAA
GGAGCATTATGCAAATATATATGCTTTGTTCCACCACAGCCATGGCCAGTTAAATTTATC
TTCGATAGCCTGATGTCCTTACTAAGGAACAATGACCCATTCAGACTTGCACAAAAATAA
GTGACTGAATAGACTGTGTTCCTCAAATGTCTGGCTTTTGGCACCTCTCCTGTTTGGGGT
ATAGAGCTTTTGTAAGGGAGGTACATGGCTTAATGTGAATTAATTTGAAAATCAGGAAGG
GAAACGTTACTTGTGCTCCATATTCCACGAATTGCATATACTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved